Variant Results

or

or

Results for "ADGRG1"

Variant Events: 8

Gene Gene symbol on which the variant is located	ID Subject Identifier from the original study	Location Genomic location of the reference allele	REF Reference allele	ALT Alternate allele	Context Variant functional categories	Variant validation performed by an orthogonal method and reported	Inheritance Reported inheritance status	Effects Variant effect on transcript per Annovar	Transcript Transcript used for the cDNA/Protein mutation	cDNA cDNA variant notation	Protein Protein variant notation	CADD-Phred v1.0 CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores	ExAC v0.3 ExAC population frequency (version 0.3)	Sources Source(s) where variants from this event are reported
ADGRG1	2-1292-003	chr16: 57678599-57678599	A	AGCACACACACTGATCACACACTCATGCAAGG	intronic		De novo					-	-	Yuen2017 G
ADGRG1	1-0161-004	chr16: 57671263-57671263	G	C	intronic		De novo					-	-	Yuen2017 G
ADGRG1	SP0070933	chr16: 57665082-57665082	C	T	intronic		De novo					-	-	Fu2022 E
ADGRG1	SP0057795	chr16: 57655684-57655684	G	A	intronic		De novo					-	-	Fu2022 E
ADGRG1	1-0564-003	chr16: 57668757-57668757	G	A	intronic		De novo					-	-	Yuen2017 G
ADGRG1	SP0057061	chr16: 57681269-57681269	C	A	intronic		De novo					-	-	Fu2022 E
ADGRG1	SP0000406	chr16: 57685044-57685044	C	T	intronic		De novo					-	-	Fu2022 E
ADGRG1	13188.p1	chr16: 57697480-57697480	T	C	exonic		De novo	nonsynonymous SNV	NM_001145773 NM_001290142 NM_001290143 NM_001290144 NM_201525 NM_001145770 NM_001145771 NM_001145772 NM_001145774 NM_005682 NM_201524	c.T2065C c.T1558C c.T1543C c.T1525C c.T2050C c.T2050C c.T2068C c.T2050C c.T2050C c.T2068C c.T2050C	p.S689P p.S520P p.S515P p.S509P p.S684P p.S684P p.S690P p.S684P p.S684P p.S690P p.S684P	14.51	1.678E-5	Ji2016 E Krumm2015 E

Source Variant Information

, -

Source:

Paper alias:

No records found.

Paper Information

Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count	The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notes	View
	More