
Results for "MROH7"

Variant Events: 10

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
MROH7     1360JS0006chr1:
CTexonicDe novosynonymous SNVNM_001291332
-2.0E-4DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
MROH7     iHART2528chr1:
TGCAGGAGAAGGACGAGGCCAAGTexonicPaternalframeshift deletionNM_001291332
--Ruzzo2019 G
MROH7     iHART2303chr1:
CTexonicMaternalstopgainNM_001039464c.C106Tp.Q36X23.68.289E-6Ruzzo2019 G
MROH7     iHART3090chr1:
GCsplicingMaternalsplicing15.28.57E-5Ruzzo2019 G
MROH7     iHART2305chr1:
CTexonicMaternalstopgainNM_001039464c.C106Tp.Q36X23.68.289E-6Ruzzo2019 G
MROH7     12792.p1chr1:
GAexonicDe novononsynonymous SNVNM_001291332
18.329.317E-6Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
MROH7     09C87111chr1:
TCsplicingDe novosplicing15.84-Fu2022 E
MROH7     11354.p1chr1:
CTexonicDe novosynonymous SNVNM_001039464c.C111Tp.P37P--Krumm2015 E
Satterstrom2020 E
MROH7     SSC05830chr1:
GAexonicDe novononsynonymous SNVNM_001291332
18.329.317E-6Fu2022 E
MROH7     SSC02558chr1:
CTexonicDe novosynonymous SNVNM_001039464c.C111Tp.P37P--Fu2022 E
Lim2017 E
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView