or
or
Exact

Results for "POC1B"

Variant Events: 11

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
POC1B     GEA469chr12:
89853410-89853410
CAintronicDe novo--Fu2022 E
POC1B     2-0022-004chr12:
89870171-89870171
TCintronicDe novo--Yuen2017 G
POC1B     1-0534-003chr12:
89965757-89965757
CTintergenicDe novo--Yuen2017 G
POC1B     14444.p1chr12:
89918931-89918931
GAexonicDe novononsynonymous SNVNM_001199782c.C326Tp.P109L16.54-Ji2016 E
Krumm2015 E
Satterstrom2020 E
POC1B     SP0042354chr12:
89919667-89919667
GAexonicDe novononsynonymous SNVNM_001199782c.C266Tp.P89L17.89-Fu2022 E
POC1B     SP0025529chr12:
89919658-89919658
CTexonicDe novononsynonymous SNVNM_001199782c.G275Ap.R92Q16.96-Fu2022 E
POC1B     SP0011516chr12:
89864133-89864133
ACintronicDe novo--Fu2022 E
POC1B     2-1591-003chr12:
89892865-89892865
GCintronicDe novo--Yuen2017 G
POC1B     2-1454-003chr12:
89951237-89951261
GATTTATTTATTTATTTATTTATTTGATTTATTTATTTATTTATTTintergenicDe novo--Yuen2017 G
POC1B     AU4173301chr12:
89912220-89912220
ATintronicDe novo--Yuen2017 G
POC1B     1-0010-005chr12:
89822340-89822340
AATintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More