or
or
Exact

Results for "TNFSF10"

Variant Events: 14

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TNFSF10     2-1283-004chr3:
172325103-172325103
GGAAAAAAAAAAACTCCATCACintergenicDe novo--Yuen2017 G
TNFSF10     7-0024-005chr3:
172311354-172311354
GCintergenicDe novo--Yuen2017 G
TNFSF10     1-0303-004chr3:
172253729-172253729
CTintergenicDe novo--Yuen2017 G
TNFSF10     1-0534-006chr3:
172325103-172325103
GGAAAAAAAAAAACTCCATCACintergenicDe novo--Yuen2017 G
TNFSF10     14695.p1chr3:
172224677-172224677
TCexonicDe novononsynonymous SNVNM_003810c.A451Gp.I151V15.3-Ji2016 E
Krumm2015 E
TNFSF10     1-0203-004chr3:
172247593-172247593
TGintergenicDe novo--Yuen2017 G
TNFSF10     1-0259-005chr3:
172306884-172306884
GAintergenicDe novo--Yuen2017 G
TNFSF10     1-0744-003chr3:
172295608-172295608
CTintergenicDe novo--Yuen2017 G
TNFSF10     1-0826-003chr3:
172293132-172293132
CTintergenicDe novo--Yuen2017 G
TNFSF10     1-0534-003chr3:
172325103-172325103
GGAAAAAAAAAACTCCATCACintergenicDe novo--Yuen2017 G
TNFSF10     1-0609-003chr3:
172263637-172263658
GTATTTATTTATTTATTTATTTGTATTTATTTATTTATTTATTTATTTintergenicDe novo--Yuen2017 G
TNFSF10     2-1497-003chr3:
172332119-172332119
GAintergenicDe novo--Yuen2017 G
TNFSF10     2-1336-004chr3:
172255720-172255720
GAintergenicDe novo--Yuen2017 G
TNFSF10     AU3122301chr3:
172268761-172268770
TCCTCCTCCCTCCTCCTCCCTCCTCCCintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More