Variant Results

or

or

Results for "ADA2"

Variant Events: 10

Gene Gene symbol on which the variant is located	ID Subject Identifier from the original study	Location Genomic location of the reference allele	REF Reference allele	ALT Alternate allele	Context Variant functional categories	Variant validation performed by an orthogonal method and reported	Inheritance Reported inheritance status	Effects Variant effect on transcript per Annovar	Transcript Transcript used for the cDNA/Protein mutation	cDNA cDNA variant notation	Protein Protein variant notation	CADD-Phred v1.0 CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores	ExAC v0.3 ExAC population frequency (version 0.3)	Sources Source(s) where variants from this event are reported
ADA2	iHART2409	chr22: 17672634-17672634	G	A	exonic		Paternal	stopgain	NM_177405 NM_001282229 NM_001282225 NM_001282226 NM_001282227 NM_001282228	c.C97T c.C460T c.C820T c.C820T c.C694T c.C694T	p.Q33X p.Q154X p.Q274X p.Q274X p.Q232X p.Q232X	24.9	-	Ruzzo2019 G
ADA2	AU4228301	chr22: 17647955-17647955	C	T	intergenic		De novo					-	-	Yuen2017 G
ADA2	iHART2411	chr22: 17672634-17672634	G	A	exonic		Paternal	stopgain	NM_177405 NM_001282229 NM_001282225 NM_001282226 NM_001282227 NM_001282228	c.C97T c.C460T c.C820T c.C820T c.C694T c.C694T	p.Q33X p.Q154X p.Q274X p.Q274X p.Q232X p.Q232X	24.9	-	Ruzzo2019 G
ADA2	iHART2410	chr22: 17672634-17672634	G	A	exonic		Paternal	stopgain	NM_177405 NM_001282229 NM_001282225 NM_001282226 NM_001282227 NM_001282228	c.C97T c.C460T c.C820T c.C820T c.C694T c.C694T	p.Q33X p.Q154X p.Q274X p.Q274X p.Q232X p.Q232X	24.9	-	Ruzzo2019 G
ADA2	iHART2412	chr22: 17672634-17672634	G	A	exonic		Paternal	stopgain	NM_177405 NM_001282229 NM_001282225 NM_001282226 NM_001282227 NM_001282228	c.C97T c.C460T c.C820T c.C820T c.C694T c.C694T	p.Q33X p.Q154X p.Q274X p.Q274X p.Q232X p.Q232X	24.9	-	Ruzzo2019 G
ADA2	2-1094-005	chr22: 17708707-17708707	C	A	intergenic		De novo					-	-	Yuen2017 G
ADA2	2-1456-004	chr22: 17699351-17699351	C	T	intronic		De novo					-	-	Yuen2017 G
ADA2	09C91621	chr22: 17662817-17662817	C	T	exonic		De novo	nonsynonymous SNV	NM_177405 NM_001282229 NM_001282225 NM_001282226 NM_001282227 NM_001282228	c.G612A c.G975A c.G1335A c.G1335A c.G1209A c.G1209A	p.M204I p.M325I p.M445I p.M445I p.M403I p.M403I	-	-	DeRubeis2014 E Fu2022 E Kosmicki2017 E Lim2017 E Neale2012 E Satterstrom2020 E
ADA2	SP0090257	chr22: 17688211-17688257	AGGGGTGAAGTCCCATCCCAGGACTCCAGGGCTTGGGGACAAAGGAG	A	intronic		De novo					-	-	Fu2022 E
ADA2	2-1336-004	chr22: 17679152-17679152	C	T	intronic		De novo					-	-	Yuen2017 G

Source Variant Information

, -

Source:

Paper alias:

No records found.

Paper Information

Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count	The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notes	View
	More