or
or
Exact

Results for "OBSCN"

Variant Events: 40

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
OBSCN     AU2072302chr1:
228525007-228525007
CTexonicDe novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.C16723T
c.C16723T
c.C19594T
p.R5575C
p.R5575C
p.R6532C
15.088.688E-5Yuen2017 G
OBSCN     iHART1901chr1:
228560587-228560587
GTexonicPaternalstopgainNM_001098623
NM_001271223
c.G22108T
c.G24979T
p.E7370X
p.E8327X
65.05.69E-5Ruzzo2019 G
OBSCN     iHART1454chr1:
228540764-228540764
GAsplicingPaternalsplicing13.43-Ruzzo2019 G
OBSCN     3A551chr1:
228559450-228559450
GCexonicDe novononsynonymous SNVNM_001098623
NM_001271223
c.G20971C
c.G23842C
p.G6991R
p.G7948R
11.56-Satterstrom2020 E
OBSCN     iHART2796chr1:
228509081-228509081
CTexonicPaternalstopgainNM_001098623
NM_052843
NM_001271223
c.C14539T
c.C14539T
c.C17410T
p.Q4847X
p.Q4847X
p.Q5804X
63.0-Ruzzo2019 G
OBSCN     3-0018-000chr1:
228504573-228504573
CGexonicDe novosynonymous SNVNM_001098623
NM_052843
NM_001271223
c.C13449G
c.C13449G
c.C16320G
p.T4483T
p.T4483T
p.T5440T
--Yuen2017 G
OBSCN     iHART3046chr1:
228554779-228554795
AGGGAGCGAGACATCCTAexonicMaternalframeshift deletionNM_001098623
NM_001271223
c.19532_19547del
c.22403_22418del
p.R6511fs
p.R7468fs
-3.632E-5Ruzzo2019 G
OBSCN     1-0413-003chr1:
228563025-228563025
CGintronicDe novo--Yuen2016 G
Yuen2017 G
OBSCN     iHART3047chr1:
228554779-228554795
AGGGAGCGAGACATCCTAexonicMaternalframeshift deletionNM_001098623
NM_001271223
c.19532_19547del
c.22403_22418del
p.R6511fs
p.R7468fs
-3.632E-5Ruzzo2019 G
OBSCN     11888.p1chr1:
228555669-228555687
ACTGCCCCAGCCATGCACCAintronicDe novo--Satterstrom2020 E
OBSCN     07C70673chr1:
228525007-228525007
CTexonicDe novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.C16723T
c.C16723T
c.C19594T
p.R5575C
p.R5575C
p.R6532C
15.088.688E-5Satterstrom2020 E
OBSCN     1-0497-003chr1:
228411813-228411813
GAintronicDe novo--Yuen2017 G
OBSCN     2-1391-003chr1:
228491517-228491517
AGexonicDe novononsynonymous SNVNM_001271223c.A13880Gp.Y4627C9.266-Yuen2017 G
OBSCN     AU4286302chr1:
228461421-228461421
GAintronicDe novo-1.816E-5Yuen2017 G
OBSCN     DEASD_0066_001chr1:
228553743-228553743
TGintronicDe novo-5.0E-4Satterstrom2020 E
OBSCN     2-1299-003chr1:
228557824-228557824
CTintronicDe novo-2.54E-5Yuen2017 G
OBSCN     AU3761302chr1:
228534143-228534143
CAintronicDe novo--Yuen2017 G
OBSCN     EGAN00001101028chr1:
228553743-228553743
TGintronicDe novo-5.0E-4Satterstrom2020 E
OBSCN     179-08-109807chr1:
228558817-228558817
CTexonicDe novononsynonymous SNVNM_001098623
NM_001271223
c.C20338T
c.C23209T
p.R6780W
p.R7737W
15.481.0E-4Satterstrom2020 E
OBSCN     13757.p1chr1:
228505699-228505699
TGexonicDe novosynonymous SNVNM_001098623
NM_052843
NM_001271223
c.T13956G
c.T13956G
c.T16827G
p.G4652G
p.G4652G
p.G5609G
-3.0E-4Satterstrom2020 E
OBSCN     7-0100-004chr1:
228523967-228523967
GAexonicDe novosynonymous SNVNM_001098623
NM_052843
NM_001271223
c.G16533A
c.G16533A
c.G19404A
p.R5511R
p.R5511R
p.R6468R
8.45-Yuen2017 G
OBSCN     11226.p1chr1:
228434310-228434310
GAexonicDe novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.G3839A
c.G3839A
c.G4115A
p.C1280Y
p.C1280Y
p.C1372Y
14.12-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
OBSCN     13705.p1chr1:
228509724-228509724
GAexonicDe novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.G15182A
c.G15182A
c.G18053A
p.R5061H
p.R5061H
p.R6018H
11.322.013E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
OBSCN     14168.p1chr1:
228538569-228538569
GAexonicMosaic, De novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.G18344A
c.G18344A
c.G21215A
p.R6115Q
p.R6115Q
p.R7072Q
23.12.512E-5Dou2017 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
OBSCN     AU2129301chr1:
228443154-228443154
AGintronicDe novo--Yuen2017 G
OBSCN     11397.p1chr1:
228548375-228548375
CTexonicDe novosynonymous SNVNM_052843c.C19782Tp.T6594T-9.37E-5Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
OBSCN     P1190chr1:
228476583-228476583
GCexonicDe novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.G10333C
c.G10333C
c.G11620C
p.V3445L
p.V3445L
p.V3874L
12.85-Hashimoto2016 E
OBSCN     12225.p1chr1:
228401952-228401952
GGCexonicDe novoframeshift insertionNM_001098623
NM_001271223
NM_052843
c.1336_1337insC
c.1336_1337insC
c.1336_1337insC
p.V446fs
p.V446fs
p.V446fs
--Satterstrom2020 E
OBSCN     Chen2017:97chr1:
228447223-228447223
AGexonicDe novononsynonymous SNVNM_001271223c.A4883Gp.K1628R14.64-Chen2017 E
OBSCN     iHART2188chr1:
228486166-228486166
CTexonicPaternalstopgainNM_001271223c.C12958Tp.R4320X62.05.261E-5Ruzzo2019 G
OBSCN     iHART3290chr1:
228476026-228476026
GAsplicingPaternalsplicing13.413.402E-5Ruzzo2019 G
OBSCN     iHART2795chr1:
228509081-228509081
CTexonicPaternalstopgainNM_001098623
NM_052843
NM_001271223
c.C14539T
c.C14539T
c.C17410T
p.Q4847X
p.Q4847X
p.Q5804X
63.0-Ruzzo2019 G
OBSCN     12929.p1chr1:
228553400-228553400
CTintronicDe novo--Wilfert2021 G
OBSCN     iHART2186chr1:
228486166-228486166
CTexonicPaternalstopgainNM_001271223c.C12958Tp.R4320X62.05.261E-5Ruzzo2019 G
OBSCN     SSC02395chr1:
228434310-228434310
GAexonicDe novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.G3839A
c.G3839A
c.G4115A
p.C1280Y
p.C1280Y
p.C1372Y
14.12-Lim2017 E
OBSCN     10C104458chr1:
228434296-228434296
TGexonicDe novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.T3825G
c.T3825G
c.T4101G
p.S1275R
p.S1275R
p.S1367R
6.1064.213E-5Lim2017 E
OBSCN     ASC_CA_129_Achr1:
228553893-228553893
CTintronicDe novo-8.421E-6Satterstrom2020 E
OBSCN     AU050910chr1:
228579473-228579473
GAintergenicDe novo--Yuen2017 G
OBSCN     iHART3291chr1:
228476026-228476026
GAsplicingPaternalsplicing13.413.402E-5Ruzzo2019 G
OBSCN     iHART1490chr1:
228465550-228465550
CTexonicMaternalstopgainNM_001098623
NM_052843
NM_001271223
c.C6850T
c.C6850T
c.C8137T
p.R2284X
p.R2284X
p.R2713X
47.07.585E-5Ruzzo2019 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More