or
or
Exact

Results for "EPHB3"

Variant Events: 12

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
EPHB3     AU003405chr3:
184308893-184308893
GAintergenicDe novo--Yuen2017 G
EPHB3     AU3713301chr3:
184353927-184353927
AGintergenicDe novo--Yuen2017 G
EPHB3     AU3911301chr3:
184351256-184351256
CTintergenicDe novo--Yuen2017 G
EPHB3     MT_76chr3:
184294872-184294872
ATexonicMaternalnonsynonymous SNVNM_004443c.A1255Tp.T419S18.43-Toma2013 E
EPHB3     Chen2017:17chr3:
184297701-184297701
CTexonicDe novosynonymous SNVNM_004443c.C2151Tp.C717C-3.331E-5Chen2017 E
EPHB3     1-0669-003chr3:
184307110-184307110
GAintergenicDe novo--Yuen2017 G
EPHB3     1-0632-003chr3:
184375055-184375087
TAGGAGGAGGAGATCTGGTTCAGGACCTGGCTGTintergenicDe novo--Yuen2017 G
EPHB3     200675356@1082034480chr3:
184297701-184297701
CTexonicDe novosynonymous SNVNM_004443c.C2151Tp.C717C-3.331E-5Satterstrom2020 E
EPHB3     2-0297-004chr3:
184388183-184388183
GCintergenicDe novo--Yuen2017 G
EPHB3     12237.p1chr3:
184298980-184298980
CAintronicDe novo-1.715E-5Satterstrom2020 E
EPHB3     3-0437-000chr3:
184335875-184335875
GCintergenicDe novo--Yuen2016 G
EPHB3     AU3506303chr3:
184318300-184318300
CGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More