or
or
Exact

Results for "PTPN11"

Variant Events: 35

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PTPN11     2-0503-003chr12:
113016549-113016549
GAintergenicDe novo--Trost2022 G
Yuen2017 G
PTPN11     SSC03013chr12:
112924272-112924273
ACAintronic--Antaki2022 GE
PTPN11     2-1167-003chr12:
112920433-112920433
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PTPN11     11625_p1chr12:
112924272-112924273
ACAintronicDe novo--Fu2022 E
PTPN11     1-0633-003chr12:
112926909-112926909
AGexonicDe novononsynonymous SNVNM_002834c.A1529Gp.Q510R28.08.238E-6Trost2022 G
Zhou2022 GE
PTPN11     1-0051-004chr12:
112893244-112893244
AGintronicDe novo--Trost2022 G
PTPN11     Ishay2021:27chr12:
112926888-112926888
GAexonicDe novononsynonymous SNVNM_002834c.G1508Ap.G503E34.0-Ishay2021 E
PTPN11     1-0385-003chr12:
112882845-112882860
ATGTGTGTGTGTGTGTATGTGTGTGTGTGTintronicDe novo--Yuen2017 G
PTPN11     MSSNG00104-003chr12:
113107784-113107784
TCintergenicDe novo--Trost2022 G
PTPN11     MSSNG00423-004chr12:
113078727-113078727
TGintergenicDe novo--Trost2022 G
PTPN11     7-0429-003chr12:
113095708-113095708
AGintergenicDe novo--Trost2022 G
PTPN11     REACH000533chr12:
113020785-113020785
CAintergenicDe novo--Trost2022 G
PTPN11     11625.p1chr12:
112924272-112924273
ACAintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Wilfert2021 G
Zhou2022 GE
PTPN11     MSSNG00249-003chr12:
113045837-113045838
AGAintergenicDe novo--Trost2022 G
PTPN11     12989.p1chr12:
112926888-112926888
GAexonicDe novononsynonymous SNVNM_002834c.G1508Ap.G503E34.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Turner2017 G
Wilfert2021 G
Zhou2022 GE
PTPN11     13324.p1chr12:
113074570-113074570
AGintergenicDe novo--Turner2016 G
PTPN11     1-0051-004chr12:
112893248-112893248
ATintronicDe novo--Trost2022 G
PTPN11     14590.p1chr12:
113126110-113126110
AGintergenicDe novo--Turner2016 G
PTPN11     H3E8D_01chr12:
112895833-112895833
CTintronicDe novo--Trost2022 G
PTPN11     AU2100302chr12:
112911189-112911189
CAintronicDe novo--Yuen2017 G
PTPN11     2-1167-003chr12:
113085394-113085430
GGTGTGTGTGTGTGTATGTGTGTGTGTGTGTGTGTGTGGTGTGTGTGTGTATGTGTGTGTGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
PTPN11     2-1336-004chr12:
113090312-113090319
ATTTGTGCAintergenicDe novo--Trost2022 G
Yuen2017 G
PTPN11     2-0022-003chr12:
113082739-113082739
ACintergenicDe novo--Trost2022 G
Yuen2017 G
PTPN11     2-0503-004chr12:
113016549-113016549
GAintergenicDe novo--Yuen2017 G
PTPN11     SSC06653chr12:
112926888-112926888
GAexonicDe novononsynonymous SNVNM_002834c.G1508Ap.G503E34.0-Antaki2022 GE
Fu2022 E
Lim2017 E
Trost2022 G
PTPN11     3-0169-000chr12:
112860691-112860691
CTintronicDe novo--Trost2022 G
Yuen2016 G
PTPN11     JASD_Fam0049chr12:
112926270-112926270
CTexonicDe novononsynonymous SNVNM_002834c.C1403Tp.T468M26.78.236E-6Takata2018 E
PTPN11     03C16396chr12:
112926888-112926888
GAexonicPaternalnonsynonymous SNVNM_002834c.G1508Ap.G503E34.0-Stessman2017 T
PTPN11     Miyake2023:17509chr12:
112926270-112926270
CTexonicDe novononsynonymous SNVNM_002834c.C1403Tp.T468M26.78.236E-6Miyake2023 E
PTPN11     1-0043-003chr12:
113113940-113113940
GTintergenicDe novo--Trost2022 G
Yuen2017 G
PTPN11     SP0053884chr12:
112892419-112892419
CGexonicDe novononsynonymous SNVNM_002834
NM_080601
c.C577G
c.C577G
p.L193V
p.L193V
25.5-Fu2022 E
Trost2022 G
Zhou2022 GE
PTPN11     SP0088140chr12:
112856949-112856949
CTintronicDe novo--Fu2022 E
Trost2022 G
Trost2022 G
PTPN11     SP0018023chr12:
112856924-112856924
GAexonicDe novosynonymous SNVNM_002834
NM_080601
c.G9A
c.G9A
p.S3S
p.S3S
--Fu2022 E
Trost2022 G
Trost2022 G
Zhou2022 GE
PTPN11     AU066404chr12:
112926888-112926888
GAexonicUnknownnonsynonymous SNVNM_002834c.G1508Ap.G503E34.0-Stessman2017 T
PTPN11     2-1337-003chr12:
113077014-113077014
CTintergenicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More