or
or
Exact

Results for "ARRB1"

Variant Events: 22

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ARRB1     2-1195-003chr11:
75008173-75008173
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
ARRB1     JASD_Fam0039chr11:
74994486-74994486
CAexonicDe novononsynonymous SNVNM_004041
NM_020251
c.G199T
c.G199T
p.D67Y
p.D67Y
24.9-Takata2018 E
ARRB1     AU2022302chr11:
75084756-75084756
GAintergenicDe novo--Yuen2017 G
ARRB1     3-0284-000chr11:
74994353-74994353
TGexonicDe novononsynonymous SNVNM_004041
NM_020251
c.A332C
c.A332C
p.H111P
p.H111P
17.48-Trost2022 G
Zhou2022 GE
ARRB1     mAGRE4337chr11:
75001084-75001084
CTsplicingPaternalsplicing25.6-Cirnigliaro2023 G
ARRB1     A26chr11:
75026483-75026483
GAintronicDe novo--Wu2018 G
ARRB1     AU3915301chr11:
74972133-74972133
GCUTR3De novo--Yuen2017 G
ARRB1     7-0188-003chr11:
75108112-75108112
GAintergenicDe novo--Yuen2017 G
ARRB1     3-0140-000chr11:
75097396-75097396
CTintergenicDe novo--Yuen2017 G
ARRB1     SP0098610chr11:
75001066-75001066
CGexonicDe novononsynonymous SNVNM_004041
NM_020251
c.G38C
c.G38C
p.S13T
p.S13T
15.99-Fu2022 E
Trost2022 G
Zhou2022 GE
ARRB1     SP0078409chr11:
75017653-75017653
GAintronicDe novo--Fu2022 E
Trost2022 G
ARRB1     SP0022233chr11:
75000993-75000993
ACintronicDe novo--Fu2022 E
ARRB1     2-0272-004chr11:
74985806-74985806
AACTGCTCCCAGGCACTCCACTintronicDe novo--Trost2022 G
Yuen2017 G
ARRB1     G01-GEA-68-HIchr11:
74978733-74978733
TAexonicDe novononsynonymous SNVNM_020251
NM_004041
c.A1084T
c.A1108T
p.T362S
p.T370S
8.0216.015E-5Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ARRB1     AU2427303chr11:
74991675-74991675
TGintronicDe novo--Trost2022 G
Yuen2017 G
ARRB1     AU076704chr11:
74994156-74994156
CAintronicDe novo--Trost2022 G
Yuen2017 G
ARRB1     SP0185662chr11:
74993012-74993012
CTexonicDe novosynonymous SNVNM_004041
NM_020251
c.G408A
c.G408A
p.T136T
p.T136T
-4.0E-4Trost2022 G
ARRB1     1-0201-004chr11:
75074449-75074449
GAintergenicDe novo--Yuen2017 G
ARRB1     2-1076-004chr11:
75022519-75022519
AGintronicDe novo--Trost2022 G
ARRB1     08C78749chr11:
74988542-74988542
TCintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
ARRB1     2-1335-004chr11:
74985801-74985801
AACTGGGAGATTGintronicDe novo--Yuen2017 G
ARRB1     AU2463301chr11:
74975562-74975562
CTUTR3De novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More