or
or
Exact

Results for "AGRN"

Variant Events: 41

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
AGRN     PN400495chr1:
982302-982302
CAexonicUnknownnonsynonymous SNVNM_198576c.C3353Ap.T1118K25.60.0021Leblond2019 E
AGRN     2-1153-003chr1:
992082-992082
TCdownstreamDe novo--Trost2022 G
AGRN     SP0174303chr1:
988838-988838
AGintronicDe novo--Trost2022 G
AGRN     PN400279chr1:
980810-980810
CTexonicUnknownnonsynonymous SNVNM_198576c.C2443Tp.R815C16.838.563E-6Leblond2019 E
AGRN     SP0157392chr1:
981953-981953
GAexonicDe novononsynonymous SNVNM_198576c.G3088Ap.V1030I0.2028.954E-6Trost2022 G
AGRN     MSSNG00339-004chr1:
981782-981782
GAexonicDe novononsynonymous SNVNM_198576c.G2917Ap.V973I0.526-Trost2022 G
AGRN     SP0166377chr1:
986864-986864
CTexonicDe novononsynonymous SNVNM_198576c.C5402Tp.P1801L7.4121.0E-4Trost2022 G
AGRN     3-0454-000chr1:
983840-983840
GTintronicDe novo--Trost2022 G
AGRN     13143.p1chr1:
989900-989900
GAexonicDe novosynonymous SNVNM_198576c.G5949Ap.T1983T--Wilfert2021 G
Zhou2022 GE
AGRN     mAGRE2565chr1:
977058-977105
CGCTCCGGCCAGTGCCAGGGTCGAGGTGAGCGGCTCCCCCGGGGGAGGCexonicMaternalnonframeshift deletionNM_198576c.1154_1177delp.385_393del-1.0E-4Cirnigliaro2023 G
AGRN     08C78500chr1:
983257-983257
GAexonicDe novononsynonymous SNVNM_198576c.G3733Ap.V1245M10.932.719E-5Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
AGRN     mAGRE2564chr1:
977058-977105
CGCTCCGGCCAGTGCCAGGGTCGAGGTGAGCGGCTCCCCCGGGGGAGGCexonicMaternalnonframeshift deletionNM_198576c.1154_1177delp.385_393del-1.0E-4Cirnigliaro2023 G
AGRN     DEASD_1021_001chr1:
983595-983595
CTexonicDe novononsynonymous SNVNM_198576c.C3955Tp.P1319S2.839-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
AGRN     SP0106850chr1:
978746-978746
CAexonicDe novononsynonymous SNVNM_198576c.C1512Ap.S504R14.36-Fu2022 E
Trost2022 G
Zhou2022 GE
AGRN     SP0145564chr1:
976257-976257
TGexonicDe novononsynonymous SNVNM_198576c.T724Gp.C242G16.47-Fu2022 E
Trost2022 G
Zhou2022 GE
AGRN     SP0095743chr1:
983404-983404
CTexonicDe novononsynonymous SNVNM_198576c.C3764Tp.A1255V9.1685.0E-4Fu2022 E
Trost2022 G
Zhou2022 GE
AGRN     SP0024272chr1:
986884-986884
GAexonicDe novononsynonymous SNVNM_198576c.G5422Ap.V1808M7.791-Fu2022 E
Trost2022 G
Zhou2022 GE
AGRN     08C74054chr1:
985272-985272
CTintronicDe novo-8.736E-6Satterstrom2020 E
Trost2022 G
AGRN     iHART2565chr1:
977058-977105
CGCTCCGGCCAGTGCCAGGGTCGAGGTGAGCGGCTCCCCCGGGGGAGGCexonicMaternalnonframeshift deletionNM_198576c.1154_1177delp.385_393del-1.0E-4Ruzzo2019 G
AGRN     5-0114-003chr1:
990815-990815
CTUTR3De novo--Trost2022 G
Yuen2017 G
AGRN     SP0031776chr1:
984172-984172
AGintronicDe novo--Fu2022 E
AGRN     iHART2564chr1:
977058-977105
CGCTCCGGCCAGTGCCAGGGTCGAGGTGAGCGGCTCCCCCGGGGGAGGCexonicMaternalnonframeshift deletionNM_198576c.1154_1177delp.385_393del-1.0E-4Ruzzo2019 G
AGRN     SP0030765chr1:
982835-982835
GAsplicingDe novosplicing8.842-Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
AGRN     SP0120214chr1:
969635-969635
GAintronicDe novo--Fu2022 E
Trost2022 G
AGRN     SP0113349chr1:
969511-969511
CGintronicDe novo--Fu2022 E
AGRN     SP0039245chr1:
981657-981657
CTintronicDe novo-1.0E-4Fu2022 E
Trost2022 G
AGRN     SP0119770chr1:
979693-979693
CGintronicDe novo--Fu2022 E
Trost2022 G
AGRN     Wang2023:95chr1:
984698-984698
CTexonicDe novononsynonymous SNVNM_198576c.C4381Tp.R1461W14.72-Wang2023 E
AGRN     SSC05601chr1:
976109-976109
GTexonicDe novosynonymous SNVNM_198576c.G576Tp.R192R--Fu2022 E
AGRN     ASC_11160-1chr1:
976241-976242
GCGexonicDe novoframeshift deletionNM_198576c.709delCp.L237fs--Fu2022 E
AGRN     80001100711chr1:
970708-970708
AGintronicDe novo--Fu2022 E
AGRN     JASD_Fam0025chr1:
980641-980649
CCTGGCTGGCexonicDe novoframeshift deletionNM_198576c.2356_2363delp.L786fs--Takata2018 E
AGRN     JASD_Fam0016chr1:
955717-955717
CTexonicDe novosynonymous SNVNM_198576c.C165Tp.L55L--Takata2018 E
AGRN     AU025704chr1:
965824-965830
CTGTGTGCTGTGintronicDe novo--Yuen2017 G
AGRN     13021.p1chr1:
955669-955672
CGAGCexonicnonframeshift deletionNM_198576c.118_120delp.40_40del--Zhou2022 GE
AGRN     13143.p2chr1:
989900-989900
GAexonicsynonymous SNVNM_198576c.G5949Ap.T1983T--Zhou2022 GE
AGRN     2-1313-003Achr1:
981205-981205
TCexonicDe novononsynonymous SNVNM_198576c.T2629Cp.C877R19.31-Trost2022 G
Zhou2022 GE
AGRN     1-0649-003chr1:
967150-967153
GTCCGintronicDe novo--Trost2022 G
AGRN     SP0076013chr1:
976975-976975
GAexonicDe novononsynonymous SNVNM_198576c.G1070Ap.C357Y15.04-Trost2022 G
AGRN     1-1121-003chr1:
975039-975039
GAintronicDe novo--Trost2022 G
AGRN     2-1313-003chr1:
981205-981205
TCexonicDe novononsynonymous SNVNM_198576c.T2629Cp.C877R19.31-Yuen2016 G
Yuen2017 G
Zhou2022 GE
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More