or
or
Exact

Results for "TCERG1L"

Variant Events: 77

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TCERG1L     1-0303-003chr10:
132891737-132891737
CTintronicDe novo--Trost2022 G
Yuen2017 G
TCERG1L     2-1371-003chr10:
133532707-133532707
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
TCERG1L     2-0013-003chr10:
133209227-133209227
GAintergenicDe novo--Yuen2017 G
TCERG1L     2-0309-004chr10:
133102732-133102733
CTGGintronicDe novo--Trost2022 G
TCERG1L     AU3506303chr10:
133285002-133285010
ACATGTATGAintergenicDe novo--Yuen2017 G
TCERG1L     2-1406-003chr10:
133542306-133542319
GACACACACACACAGACACACACACAintergenicDe novo--Yuen2017 G
TCERG1L     3-0458-000Bchr10:
133244178-133244178
CTintergenicDe novo--Yuen2017 G
TCERG1L     2-0285-004chr10:
133145522-133145522
CCTTTCTintergenicDe novo--Yuen2017 G
TCERG1L     JASD_Fam0021chr10:
133109867-133109867
CTexonicDe novononsynonymous SNVNM_174937c.G32Ap.R11Q8.017-Takata2018 E
TCERG1L     1-0290-003chr10:
133310938-133310938
TTGintergenicDe novo--Yuen2017 G
TCERG1L     1-0007-003chr10:
132974707-132974707
GAintronicDe novo--Yuen2017 G
TCERG1L     AU3849303chr10:
133317424-133317424
GAintergenicDe novo--Yuen2017 G
TCERG1L     1-0007-003chr10:
133518784-133518814
TTCTCTCTCTCTCTCTGTCTCTCTCTCTCTCTTCTCTCTCTCTCTGTCTCTCTCTCTCTCintergenicDe novo--Yuen2017 G
TCERG1L     13143.p1chr10:
132890047-132890047
CTdownstreamDe novo--Wilfert2021 G
TCERG1L     AU057405chr10:
132917761-132917761
AGintronicDe novo--Trost2022 G
Yuen2017 G
TCERG1L     13730.p1chr10:
132915185-132915185
GAexonicDe novosynonymous SNVNM_174937c.C1272Tp.C424C-8.0E-4Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
Zhou2022 GE
TCERG1L     2-1330-003chr10:
133315246-133315246
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
TCERG1L     13570.p1chr10:
132965064-132965064
TCexonicDe novo, Mosaic Mat.nonsynonymous SNVNM_174937c.A941Gp.D314G8.341-Dou2017 E
Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
TCERG1L     1-0978-003chr10:
133367328-133367328
CTintergenicDe novo--Yuen2017 G
TCERG1L     1-0006-004chr10:
133310910-133310910
GGTTGTATintergenicDe novo--Yuen2017 G
TCERG1L     SSC08103chr10:
132965064-132965064
TCexonicDe novononsynonymous SNVNM_174937c.A941Gp.D314G8.341-Fu2022 E
Lim2017 E
Trost2022 G
TCERG1L     AU3874301chr10:
132974866-132974871
CAGAGACAGAintronicDe novo--Yuen2017 G
TCERG1L     mAGRE1606chr10:
132944925-132944925
TGsplicingPaternalsplicing19.11-Cirnigliaro2023 G
TCERG1L     5-0106-003chr10:
133133607-133133607
GTintergenicDe novo--Yuen2017 G
TCERG1L     2-1339-003chr10:
133112865-133112865
CTintergenicDe novo--Yuen2017 G
TCERG1L     AU4024303chr10:
133330730-133330730
GAintergenicDe novo--Yuen2017 G
TCERG1L     1-0539-003chr10:
133310940-133310940
GGTGTintergenicDe novo--Yuen2017 G
TCERG1L     3-0458-000Achr10:
133244178-133244178
CTintergenicDe novo--Yuen2017 G
TCERG1L     1-0563-004chr10:
133522779-133522779
TAintergenicDe novo--Yuen2017 G
TCERG1L     AU2123302chr10:
133106179-133106179
CAintronicDe novo--Trost2022 G
Yuen2017 G
TCERG1L     EGAN00001101080chr10:
133058648-133058654
CGGCGGTCexonicDe novononframeshift deletionNM_174937c.724_729delp.242_243del--Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
TCERG1L     2-1146-003chr10:
133540750-133540750
GAintergenicDe novo--Yuen2017 G
TCERG1L     2-1250-003chr10:
133327185-133327185
ATintergenicDe novo--Yuen2017 G
TCERG1L     AU3052303chr10:
133218312-133218312
AGintergenicDe novo--Yuen2017 G
TCERG1L     AU038204chr10:
133086123-133086123
GAintronicDe novo--Yuen2017 G
TCERG1L     SP0042511chr10:
133109654-133109654
GAexonicDe novononsynonymous SNVNM_174937c.C245Tp.A82V0.016-Fu2022 E
Trost2022 G
Zhou2022 GE
TCERG1L     2-0289-004chr10:
133217583-133217583
GAintergenicDe novo--Yuen2017 G
TCERG1L     1-0458-003chr10:
133522840-133522840
CTintergenicDe novo--Yuen2017 G
TCERG1L     SSC08374chr10:
132915185-132915185
GAexonicDe novosynonymous SNVNM_174937c.C1272Tp.C424C-8.0E-4Trost2022 G
TCERG1L     2-1322-003chr10:
133072165-133072165
GAintronicDe novo--Trost2022 G
Yuen2017 G
TCERG1L     AU4372309chr10:
133024563-133024563
CGintronicDe novo--Yuen2017 G
TCERG1L     1-0142-005chr10:
133522836-133522836
CCAATCACACTCAintergenicDe novo--Yuen2017 G
TCERG1L     2-1180-003chr10:
132965082-132965082
CTexonicDe novononsynonymous SNVNM_174937c.G923Ap.R308Q2.5172.493E-5Trost2022 G
Yuen2016 G
Yuen2017 G
Zhou2022 GE
TCERG1L     7-0202-003chr10:
132980935-132980935
CGintronicDe novo--Trost2022 G
TCERG1L     7-0353-003chr10:
132985048-132985048
CTintronicDe novo--Trost2022 G
TCERG1L     2-1246-003chr10:
133448168-133448168
GGTGATGGATGCACAGGTGTATGGAGGCGCAGAintergenicDe novo--Yuen2017 G
TCERG1L     MSSNG00423-004chr10:
132945298-132945298
GAintronicDe novo--Trost2022 G
TCERG1L     2-1629-003chr10:
133324666-133324666
AGintergenicDe novo--Yuen2017 G
TCERG1L     MSSNG00056-003chr10:
132974146-132974146
CTintronicDe novo--Trost2022 G
TCERG1L     MT_74.3chr10:
132929984-132929984
CTintronicDe novo--Trost2022 G
TCERG1L     7-0365-004chr10:
132933727-132933727
AGintronicDe novo--Trost2022 G
TCERG1L     2-1451-004chr10:
133071685-133071685
GAintronicDe novo--Trost2022 G
Yuen2017 G
TCERG1L     2-1818-003chr10:
132927041-132927041
CAintronicDe novo--Trost2022 G
TCERG1L     1-0599-005chr10:
132929206-132929206
GAintronicDe novo--Trost2022 G
TCERG1L     MSSNG00173-003chr10:
133079486-133079486
GAintronicDe novo--Trost2022 G
TCERG1L     1-0541-004chr10:
133080048-133080054
GATCCGCTGGCAGGAGAintronicDe novo--Trost2022 G
TCERG1L     5-5131-003chr10:
133047126-133047126
CCTintronicDe novo--Trost2022 G
TCERG1L     3-0458-000chr10:
133244178-133244178
CTintergenicDe novo--Yuen2016 G
TCERG1L     MT_73.3chr10:
133072678-133072678
CTintronicDe novo--Trost2022 G
TCERG1L     4-0094-003chr10:
133021082-133021082
AGintronicDe novo--Trost2022 G
TCERG1L     3-0007-000chr10:
133024180-133024180
CAintronicDe novo--Trost2022 G
TCERG1L     2-1644-003chr10:
133522840-133522840
CTintergenicDe novo--Yuen2017 G
TCERG1L     1-0665-003chr10:
132993128-132993129
CACintronicDe novo--Trost2022 G
TCERG1L     1-0158-012chr10:
133310645-133310645
TTGCintergenicDe novo--Yuen2017 G
TCERG1L     3-0307-000chr10:
133469928-133469928
TCintergenicDe novo--Yuen2017 G
TCERG1L     AU2218301chr10:
132993248-132993248
AGintronicDe novo--Trost2022 G
TCERG1L     3-0783-000chr10:
133087074-133087075
AGAintronicDe novo--Trost2022 G
TCERG1L     AU055603chr10:
133098373-133098373
TTAintronicDe novo--Trost2022 G
TCERG1L     3-0466-000Achr10:
133080096-133080096
TAintronicDe novo--Trost2022 G
TCERG1L     iHART1606chr10:
132944925-132944925
TGsplicingPaternalsplicing19.11-Ruzzo2019 G
TCERG1L     AU3724302chr10:
133080096-133080096
TAintronicDe novo--Trost2022 G
TCERG1L     2-1744-003chr10:
133080096-133080096
TAintronicDe novo--Trost2022 G
TCERG1L     2-1765-003chr10:
133080096-133080096
TAintronicDe novo--Trost2022 G
TCERG1L     AU072505chr10:
133439139-133439139
CTintergenicDe novo--Yuen2017 G
TCERG1L     1-0354-003chr10:
133080052-133080054
CGCGAGAintronicDe novo--Trost2022 G
TCERG1L     REACH000065chr10:
132944851-132944851
CTexonicDe novosynonymous SNVNM_174937c.G1107Ap.K369K--Trost2022 G
Zhou2022 GE
TCERG1L     1-1212-003chr10:
133080096-133080096
TAintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More