or
or
Exact

Results for "CDH2"

Variant Events: 123

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CDH2     7-0253-005chr18:
26713714-26713714
GAintergenicDe novo--Yuen2017 G
CDH2     7-0253-005chr18:
26716961-26716961
GCintergenicDe novo--Yuen2017 G
CDH2     SP0091585chr18:
25585868-25585868
TCexonicDe novosynonymous SNVNM_001308176
NM_001792
c.A699G
c.A792G
p.R233R
p.R264R
--Fu2022 E
Zhou2022 GE
CDH2     1-0381-003chr18:
26165399-26165399
GAintergenicDe novo--Yuen2017 G
CDH2     AU0638302chr18:
27460599-27460599
CTintergenicDe novo--Yuen2017 G
CDH2     1-0299-003chr18:
26126858-26126858
AGintergenicDe novo--Yuen2017 G
CDH2     7-0247-003chr18:
26504086-26504100
CATATATATATATATCATATATATATATintergenicDe novo--Yuen2017 G
CDH2     1-0121-003chr18:
26996993-26996993
CTintergenicDe novo--Yuen2017 G
CDH2     1-0555-003chr18:
26593863-26593863
TCintergenicDe novo--Yuen2017 G
CDH2     2-1373-003chr18:
25886847-25886847
CAintergenicDe novo--Yuen2017 G
CDH2     1-0826-004chr18:
25817399-25817399
AGintergenicDe novo--Yuen2017 G
CDH2     5-0129-003chr18:
26325762-26325762
GCintergenicDe novo--Yuen2017 G
CDH2     13143.p1chr18:
26351525-26351525
AGintergenicDe novo--Wilfert2021 G
CDH2     2-1305-003chr18:
26440458-26440458
ACintergenicDe novo--Yuen2017 G
CDH2     2-0149-003chr18:
27759322-27759322
AGintergenicDe novo--Yuen2017 G
CDH2     1-0436-003chr18:
27251530-27251530
GAintergenicDe novo--Yuen2016 G
CDH2     AU3881301chr18:
27011001-27011001
CTintergenicDe novo--Yuen2017 G
CDH2     2-1127-003chr18:
27429697-27429697
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
CDH2     AU3900301chr18:
27608227-27608227
CGintergenicDe novo--Yuen2017 G
CDH2     2-1702-003chr18:
27762025-27762025
AATATintergenicDe novo--Yuen2017 G
CDH2     3-0246-000chr18:
26929960-26929960
TCintergenicDe novo--Yuen2017 G
CDH2     5-0015-003chr18:
27759221-27759221
AGintergenicDe novo--Yuen2017 G
CDH2     2-1619-004chr18:
26917945-26917945
TTATAintergenicDe novo--Yuen2017 G
CDH2     2-1619-004chr18:
25769120-25769120
GGAGTCintergenicDe novo--Yuen2017 G
CDH2     12362.p1chr18:
25532312-25532312
CTexonicDe novosynonymous SNVNM_001308176
NM_001792
c.G2433A
c.G2526A
p.A811A
p.A842A
-2.479E-5Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Zhou2022 GE
CDH2     AU4347301chr18:
27318490-27318492
ATTATTTintergenicDe novo--Yuen2017 G
CDH2     AU1725306chr18:
26933623-26933623
GAintergenicDe novo--Yuen2017 G
CDH2     2-1343-003chr18:
27286679-27286703
TTTGTTGTTGTTGTTGTTGTTGTTGTTTGTTGTTGTTGTTGTTGTTGintergenicDe novo--Yuen2017 G
CDH2     SSC04909chr18:
25532312-25532312
CTexonicDe novosynonymous SNVNM_001308176
NM_001792
c.G2433A
c.G2526A
p.A811A
p.A842A
-2.479E-5Fu2022 E
Trost2022 G
CDH2     14260.p1chr18:
26400387-26400387
GAintergenicDe novo--Werling2018 G
CDH2     2-0197-004chr18:
27499667-27499667
ATintergenicDe novo--Yuen2017 G
CDH2     1-0272-003chr18:
27759229-27759229
AGintergenicDe novo--Yuen2017 G
CDH2     1-0520-003chr18:
26666303-26666303
CAintergenicDe novo--Yuen2016 G
CDH2     1-0019-004chr18:
27438331-27438331
CTintergenicDe novo--Yuen2017 G
CDH2     AU4054302chr18:
27234159-27234159
AGintergenicDe novo--Yuen2017 G
CDH2     1-0484-003chr18:
27453004-27453004
CAintergenicDe novo--Yuen2017 G
CDH2     1-0006-004chr18:
25725316-25725316
GAintronicDe novo--Trost2022 G
Yuen2017 G
CDH2     1-0627-007chr18:
27554434-27554434
CGintergenicDe novo--Yuen2017 G
CDH2     2-0309-004chr18:
26198359-26198359
GAintergenicDe novo--Yuen2017 G
CDH2     2-1186-003chr18:
27559769-27559769
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
CDH2     1-0025-006chr18:
27248664-27248664
TCintergenicDe novo--Yuen2017 G
CDH2     2-1581-003chr18:
26295326-26295326
GAintergenicDe novo--Yuen2017 G
CDH2     7-0002-003chr18:
26684502-26684502
AGintergenicDe novo--Yuen2017 G
CDH2     1-0233-004chr18:
27759221-27759221
AGintergenicDe novo--Yuen2017 G
CDH2     5-0131-003chr18:
27250657-27250657
AGintergenicDe novo--Yuen2017 G
CDH2     Miyake2023:16791chr18:
25589713-25589713
GAexonicDe novononsynonymous SNVNM_001308176
NM_001792
c.C577T
c.C670T
p.P193S
p.P224S
33.0-Miyake2023 E
CDH2     1-0403-003chr18:
27286836-27286836
GAintergenicDe novo--Yuen2017 G
CDH2     1-0455-004chr18:
26838068-26838068
TCintergenicDe novo--Yuen2017 G
CDH2     1-0099-003chr18:
27290275-27290275
TCintergenicDe novo--Yuen2017 G
CDH2     2-1350-004chr18:
27703494-27703494
GAintergenicDe novo--Yuen2017 G
CDH2     AU3053302chr18:
26255300-26255300
CGintergenicDe novo--Yuen2017 G
CDH2     AU3649304chr18:
26813893-26813893
TCintergenicDe novo--Yuen2017 G
CDH2     AU4093304chr18:
26239692-26239692
GTintergenicDe novo--Yuen2017 G
CDH2     AU4093304chr18:
26248815-26248815
TAintergenicDe novo--Yuen2017 G
CDH2     JASD_Fam0038chr18:
25589713-25589713
GAexonicDe novononsynonymous SNVNM_001308176
NM_001792
c.C577T
c.C670T
p.P193S
p.P224S
33.0-Takata2018 E
CDH2     1-0556-003chr18:
27390549-27390549
CTintergenicDe novo--Yuen2017 G
CDH2     2-0149-004chr18:
27759322-27759322
AGintergenicDe novo--Yuen2017 G
CDH2     1-0674-004chr18:
27463448-27463448
TCintergenicDe novo--Yuen2017 G
CDH2     AU2089302chr18:
26912704-26912704
TGintergenicDe novo--Yuen2017 G
CDH2     AU073003chr18:
27111231-27111237
CAGAGAGCAGAGintergenicDe novo--Yuen2017 G
CDH2     1-0272-004chr18:
26680266-26680266
AGintergenicDe novo--Yuen2017 G
CDH2     2-0002-005chr18:
25655561-25655561
GAintronicDe novo--Trost2022 G
Yuen2017 G
CDH2     1-0346-004chr18:
25735014-25735014
TCintronicDe novo--Trost2022 G
Yuen2017 G
CDH2     7-0194-003chr18:
26688811-26688811
AGintergenicDe novo--Yuen2017 G
CDH2     3-0396-000chr18:
27244553-27244553
GAintergenicDe novo--Yuen2016 G
CDH2     1-0560-003chr18:
25959409-25959409
TCintergenicDe novo--Yuen2017 G
CDH2     AU2022302chr18:
27431968-27431968
AGintergenicDe novo--Yuen2017 G
CDH2     1-0120-003chr18:
27154056-27154056
AGintergenicDe novo--Yuen2017 G
CDH2     1-0303-003chr18:
25871803-25871803
TAintergenicDe novo--Yuen2017 G
CDH2     5-0128-003chr18:
26843649-26843649
CTintergenicDe novo--Yuen2017 G
CDH2     2-1627-003chr18:
27236141-27236141
AGintergenicDe novo--Yuen2017 G
CDH2     AU4152303chr18:
27099642-27099642
TAintergenicDe novo--Yuen2017 G
CDH2     1-0045-004chr18:
26823007-26823007
ATintergenicDe novo--Yuen2017 G
CDH2     2-1138-003chr18:
26619629-26619629
CGintergenicDe novo--Yuen2017 G
CDH2     AU4235303chr18:
26948172-26948172
GCintergenicDe novo--Yuen2017 G
CDH2     2-1169-003chr18:
26747284-26747284
TCintergenicDe novo--Yuen2017 G
CDH2     1-0489-003chr18:
26202874-26202874
GCintergenicDe novo--Yuen2017 G
CDH2     2-1169-003chr18:
26293064-26293064
CTintergenicDe novo--Yuen2017 G
CDH2     2-0272-003chr18:
27256256-27256256
GAintergenicDe novo--Yuen2017 G
CDH2     1-0184-003chr18:
26831604-26831612
CATAGATAGCATAGintergenicDe novo--Yuen2017 G
CDH2     2-1438-003chr18:
27354975-27354975
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
CDH2     2-1357-003chr18:
26160682-26160682
CTintergenicDe novo--Yuen2017 G
CDH2     2-0309-005chr18:
26661563-26661563
TCintergenicDe novo--Yuen2017 G
CDH2     1-0863-003chr18:
25985276-25985276
GAintergenicDe novo--Yuen2017 G
CDH2     2-1437-003chr18:
26021906-26021906
CTintergenicDe novo--Yuen2017 G
CDH2     2-1577-003chr18:
27581869-27581870
CACintergenicDe novo--Yuen2017 G
CDH2     AU3057301chr18:
27151127-27151127
CTintergenicDe novo--Yuen2017 G
CDH2     1-0898-003chr18:
26132197-26132197
CTintergenicDe novo--Yuen2017 G
CDH2     1-0591-003chr18:
25735235-25735252
GTAATAATAATAATAATAGTAATAATAATAATAintronicDe novo--Yuen2017 G
CDH2     1-0435-003chr18:
27064257-27064257
AGintergenicDe novo--Yuen2017 G
CDH2     AU3154301chr18:
26548415-26548415
AGintergenicDe novo--Yuen2017 G
CDH2     2-1348-003chr18:
25671457-25671457
TCintronicDe novo--Trost2022 G
Yuen2017 G
CDH2     MSSNG00011-003chr18:
25707158-25707159
CTCintronicDe novo--Trost2022 G
CDH2     5-0033-004chr18:
27244329-27244329
TCintergenicDe novo--Yuen2017 G
CDH2     AU2320301chr18:
25730273-25730273
GTintronicDe novo--Trost2022 G
CDH2     MSSNG00140-003chr18:
25664721-25664721
CGintronicDe novo--Trost2022 G
CDH2     SJD_71.3chr18:
25704033-25704033
CCGintronicDe novo--Trost2022 G
CDH2     2-1800-003chr18:
25577628-25577628
GCintronicDe novo--Trost2022 G
CDH2     T2T9E-01chr18:
25617107-25617107
TCintronicDe novo--Trost2022 G
CDH2     MSSNG00431-003chr18:
25551287-25551287
TGintronicDe novo--Trost2022 G
CDH2     1-0320-004chr18:
26357467-26357467
ATintergenicDe novo--Yuen2017 G
CDH2     1-0202-003chr18:
25574554-25574554
GCintronicDe novo--Trost2022 G
CDH2     2-1525-003chr18:
25821148-25821148
TGintergenicDe novo--Yuen2017 G
CDH2     1-0969-003chr18:
26972197-26972203
CAAAAAACAAAAAAAintergenicDe novo--Yuen2017 G
CDH2     AU4412302chr18:
26985013-26985013
CTintergenicDe novo--Yuen2017 G
CDH2     MSSNG00201-003chr18:
25746147-25746147
TAintronicDe novo--Trost2022 G
CDH2     5-0058-003chr18:
25746274-25746274
TCintronicDe novo--Trost2022 G
CDH2     AU2123302chr18:
26953340-26953340
GTintergenicDe novo--Yuen2017 G
CDH2     12493.p1chr18:
26851291-26851291
CTintergenicDe novo--Turner2016 G
CDH2     2-0132-004chr18:
25918897-25918897
TCintergenicDe novo--Yuen2017 G
CDH2     AU073005chr18:
26790488-26790488
CTintergenicDe novo--Yuen2017 G
CDH2     AU3302302chr18:
27080419-27080419
GCintergenicDe novo--Yuen2017 G
CDH2     2-0063-003chr18:
27030784-27030784
TGintergenicDe novo--Yuen2017 G
CDH2     AU1698301chr18:
27017994-27017994
GAintergenicDe novo--Yuen2017 G
CDH2     G01-GEA-84-HIchr18:
25616535-25616535
TCUTR5De novo--Satterstrom2020 E
Trost2022 G
CDH2     2-0006-004chr18:
25912880-25912880
AGintergenicDe novo--Yuen2017 G
CDH2     AU4235301chr18:
27054884-27054884
TCintergenicDe novo--Yuen2017 G
CDH2     AU4378301chr18:
26748163-26748163
CTintergenicDe novo--Yuen2017 G
CDH2     AU2863302chr18:
25941506-25941506
CTintergenicDe novo--Yuen2017 G
CDH2     1-0563-003chr18:
27342328-27342328
CTintergenicDe novo--Yuen2017 G
CDH2     5-0083-003chr18:
26879945-26879945
CAintergenicDe novo--Yuen2017 G
CDH2     2-0270-003chr18:
26591221-26591221
AACintergenicDe novo--Yuen2017 G
CDH2     AU2458302chr18:
26088031-26088031
ATintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More