or
or
Exact

Results for "FOXP1"

Variant Events: 148

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FOXP1     1-0368-004chr3:
71376590-71376590
GAintronicDe novo--Yuen2017 G
FOXP1     AU4237302chr3:
71100544-71100544
ATintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     HEN0212.p1chr3:
71102906-71102906
TCexonicMaternalnonsynonymous SNVNM_001244813
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.A1G
c.A307G
c.A301G
c.A301G
c.A301G
c.A301G
c.A301G
p.M1V
p.M103V
p.M101V
p.M101V
p.M101V
p.M101V
p.M101V
16.683.297E-5Guo2018 T
FOXP1     2-0057-003chr3:
71376590-71376590
GAintronicDe novo--Yuen2017 G
FOXP1     AU060004 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
FOXP1     2-1134-003chr3:
71043885-71043885
GAintronicDe novo--Yuen2017 G
FOXP1     11403.p1chr3:
71026115-71026115
GAexonicDe novostopgainNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.C1207T
c.C1279T
c.C1513T
c.C1507T
c.C1507T
c.C1504T
c.C1507T
c.C1507T
p.R403X
p.R427X
p.R505X
p.R503X
p.R503X
p.R502X
p.R503X
p.R503X
37.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Zhou2022 GE
FOXP1     12817.p1 Complex Event; expand row to view variants  De novoframeshift insertionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
NM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.714dupA
c.786dupA
c.1020dupA
c.1014dupA
c.1014dupA
c.1014dupA
c.1014dupA
c.1014dupA
c.714dupA
c.786dupA
c.1020dupA
c.1014dupA
c.1014dupA
c.1014dupA
c.1014dupA
c.1014dupA
p.A239fs
p.A263fs
p.A341fs
p.A339fs
p.A339fs
p.A339fs
p.A339fs
p.A339fs
p.T238fs
p.T262fs
p.T340fs
p.T338fs
p.T338fs
p.T338fs
p.T338fs
p.T338fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Wilfert2021 G
Willsey2013 E
Zhou2022 GE
FOXP1     M21566chr3:
71064722-71064722
CTexonicPaternalnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.G652A
c.G724A
c.G958A
c.G952A
c.G952A
c.G952A
c.G952A
c.G952A
p.E218K
p.E242K
p.E320K
p.E318K
p.E318K
p.E318K
p.E318K
p.E318K
36.0-Guo2018 T
Wang2016 T
FOXP1     M23720chr3:
71247418-71247418
CTexonicMaternal, Unknownnonsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.G115A
c.G115A
c.G115A
c.G115A
c.G115A
c.G115A
c.G115A
p.G39R
p.G39R
p.G39R
p.G39R
p.G39R
p.G39R
p.G39R
31.01.653E-5Guo2018 T
Stessman2017 T
Wang2016 T
FOXP1     HN0004.p1chr3:
71027085-71027086
CACexonicDe novoframeshift deletionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.941delT
c.1013delT
c.1247delT
c.1241delT
c.1241delT
c.1241delT
c.1241delT
c.1241delT
p.L314fs
p.L338fs
p.L416fs
p.L414fs
p.L414fs
p.L414fs
p.L414fs
p.L414fs
--Guo2018 T
FOXP1     2-1322-004chr3:
71096804-71096804
AGintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     AU4186302chr3:
71049338-71049338
ATintronicDe novo--Yuen2017 G
FOXP1     7-0248-003chr3:
71316025-71316025
CTintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     M30624chr3:
71027165-71027165
TTTGATACCAGATTCAACTGCAAGGAAAAAAACAACGTCTTAexonicMaternalstopgainNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.861_862insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.933_934insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.1167_1168insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.1161_1162insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.1161_1162insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.1161_1162insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.1161_1162insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.1161_1162insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
p.S288_V289delinsX
p.S312_V313delinsX
p.S390_V391delinsX
p.S388_V389delinsX
p.S388_V389delinsX
p.S388_V389delinsX
p.S388_V389delinsX
p.S388_V389delinsX
--Guo2018 T
FOXP1     Chen2017:85chr3:
71027145-71027145
GGGACTTexonicDe novoframeshift insertionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.881_882insAAGTC
c.953_954insAAGTC
c.1187_1188insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
p.S294fs
p.S318fs
p.S396fs
p.S394fs
p.S394fs
p.S394fs
p.S394fs
p.S394fs
--Chen2017 E
FOXP1     M02533chr3:
71247153-71247153
GTexonicMaternalnonsynonymous SNVNM_001012505c.C247Ap.P83T15.86-Guo2018 T
FOXP1     SP0263417chr3:
71027072-71027072
GAexonicstopgainNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.C955T
c.C1027T
c.C1261T
c.C1255T
c.C1255T
c.C1255T
c.C1255T
c.C1255T
p.Q319X
p.Q343X
p.Q421X
p.Q419X
p.Q419X
p.Q419X
p.Q419X
p.Q419X
38.0-Zhou2022 GE
FOXP1     M26811chr3:
71179825-71179825
ATexonicMaternalnonsynonymous SNVNM_001244815c.T10Ap.C4S12.92-Guo2018 T
FOXP1     SP0087128chr3:
71026813-71026813
TCexonicnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.A1109G
c.A1181G
c.A1415G
c.A1409G
c.A1409G
c.A1406G
c.A1409G
c.A1409G
p.Y370C
p.Y394C
p.Y472C
p.Y470C
p.Y470C
p.Y469C
p.Y470C
p.Y470C
17.468.241E-6Zhou2022 GE
FOXP1     12817_p1chr3:
71050170-71050170
CCTexonicDe novoframeshift insertionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.714dupA
c.786dupA
c.1020dupA
c.1014dupA
c.1014dupA
c.1014dupA
c.1014dupA
c.1014dupA
p.A239fs
p.A263fs
p.A341fs
p.A339fs
p.A339fs
p.A339fs
p.A339fs
p.A339fs
--Fu2022 E
FOXP1     M16136chr3:
71015162-71015162
TCexonicMaternalnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.A1468G
c.A1540G
c.A1774G
c.A1768G
c.A1768G
c.A1765G
c.A1816G
c.A1768G
p.M490V
p.M514V
p.M592V
p.M590V
p.M590V
p.M589V
p.M606V
p.M590V
14.794.119E-5Guo2018 T
FOXP1     SP0147668chr3:
71026803-71026803
TAexonicnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.A1119T
c.A1191T
c.A1425T
c.A1419T
c.A1419T
c.A1416T
c.A1419T
c.A1419T
p.L373F
p.L397F
p.L475F
p.L473F
p.L473F
p.L472F
p.L473F
p.L473F
18.37-Zhou2022 GE
FOXP1     M26196chr3:
71015104-71015104
GAexonicMaternalnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.C1526T
c.C1598T
c.C1832T
c.C1826T
c.C1826T
c.C1823T
c.C1874T
c.C1826T
p.A509V
p.A533V
p.A611V
p.A609V
p.A609V
p.A608V
p.A625V
p.A609V
17.941.647E-5Guo2018 T
FOXP1     SP0360146chr3:
71026115-71026115
GAexonicstopgainNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.C1207T
c.C1279T
c.C1513T
c.C1507T
c.C1507T
c.C1504T
c.C1507T
c.C1507T
p.R403X
p.R427X
p.R505X
p.R503X
p.R503X
p.R502X
p.R503X
p.R503X
37.0-Zhou2022 GE
FOXP1     JS0070.p1chr3:
71027086-71027086
AAGexonicDe novoframeshift insertionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.940dupC
c.1012dupC
c.1246dupC
c.1240dupC
c.1240dupC
c.1240dupC
c.1240dupC
c.1240dupC
p.L314fs
p.L338fs
p.L416fs
p.L414fs
p.L414fs
p.L414fs
p.L414fs
p.L414fs
--Guo2018 T
FOXP1     Ohashi2021:ASD-160chr3:
71026789-71026789
CTintronic--Ohashi2021 ET
FOXP1     200675573_1082035017chr3:
71027145-71027145
GGGACTTexonicDe novoframeshift insertionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.881_882insAAGTC
c.953_954insAAGTC
c.1187_1188insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
p.S294fs
p.S318fs
p.S396fs
p.S394fs
p.S394fs
p.S394fs
p.S394fs
p.S394fs
--Fu2022 E
FOXP1     1-0037-004chr3:
71021763-71021763
GAexonicDe novononsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_032682
c.C1295T
c.C1367T
c.C1601T
c.C1595T
c.C1595T
c.C1592T
c.C1595T
p.A432V
p.A456V
p.A534V
p.A532V
p.A532V
p.A531V
p.A532V
27.48.237E-6Trost2022 G
Zhou2022 GE
FOXP1     MSSNG00016-003chr3:
71015081-71015081
CTexonicDe novononsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.G1549A
c.G1621A
c.G1855A
c.G1849A
c.G1849A
c.G1846A
c.G1897A
c.G1849A
p.E517K
p.E541K
p.E619K
p.E617K
p.E617K
p.E616K
p.E633K
p.E617K
22.8-Trost2022 G
Zhou2022 GE
FOXP1     Disecmas_121Pchr3:
71096183-71096183
GGTexonicDe novoframeshift insertionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.273dupA
c.345dupA
c.579dupA
c.573dupA
c.573dupA
c.573dupA
c.573dupA
c.573dupA
p.Q92fs
p.Q116fs
p.Q194fs
p.Q192fs
p.Q192fs
p.Q192fs
p.Q192fs
p.Q192fs
--Fu2022 E
FOXP1     AU2514301chr3:
71101750-71101750
GGTexonicframeshift insertionNM_001244813
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.147dupA
c.453dupA
c.447dupA
c.447dupA
c.447dupA
c.447dupA
c.447dupA
p.Q50fs
p.Q152fs
p.Q150fs
p.Q150fs
p.Q150fs
p.Q150fs
p.Q150fs
--Zhou2022 GE
FOXP1     AU1860302chr3:
71251048-71251048
AGintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     2-1644-003chr3:
71572853-71572853
GGAintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     SX0015.p1chr3:
71096193-71096193
CTexonicPaternalnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.G264A
c.G336A
c.G570A
c.G564A
c.G564A
c.G564A
c.G564A
c.G564A
p.M88I
p.M112I
p.M190I
p.M188I
p.M188I
p.M188I
p.M188I
p.M188I
16.31-Guo2018 T
FOXP1     GX0547.p1chr3:
71179794-71179798
TGCGGTexonicMaternalframeshift deletionNM_001244815c.37_40delp.P13fs--Guo2018 T
FOXP1     AU4269301chr3:
71169564-71169564
CTintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     1-0285-003chr3:
71263767-71263767
ATintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     AU3891303chr3:
71443178-71443178
CTintronicDe novo--Yuen2017 G
FOXP1     HN0001.p1chr3:
71247125-71247125
GAexonicPaternalnonsynonymous SNVNM_001012505c.C275Tp.P92L15.78-Guo2018 T
FOXP1     GX0101.p1chr3:
71027165-71027165
TCexonicPaternalnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.A862G
c.A934G
c.A1168G
c.A1162G
c.A1162G
c.A1162G
c.A1162G
c.A1162G
p.S288G
p.S312G
p.S390G
p.S388G
p.S388G
p.S388G
p.S388G
p.S388G
15.19-Guo2018 T
FOXP1     2-1693-003chr3:
71037477-71037477
GAintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     08C72698chr3:
71050205-71050205
AGexonicDe novononsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.T680C
c.T752C
c.T986C
c.T980C
c.T980C
c.T980C
c.T980C
c.T980C
p.L227P
p.L251P
p.L329P
p.L327P
p.L327P
p.L327P
p.L327P
p.L327P
23.4-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
FOXP1     AU3859301chr3:
71247280-71247280
CTintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     1-0161-003chr3:
71067022-71067024
CTGCintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     2-1174-006chr3:
71242618-71242618
TTGintronicDe novo--Yuen2017 G
FOXP1     211-5583-3chr3:
71064721-71064721
TAexonicUnknownnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.A653T
c.A725T
c.A959T
c.A953T
c.A953T
c.A953T
c.A953T
c.A953T
p.E218V
p.E242V
p.E320V
p.E318V
p.E318V
p.E318V
p.E318V
p.E318V
29.5-Stessman2017 T
FOXP1     11625.p1chr3:
71593936-71593936
TCintronicDe novo--Wilfert2021 G
FOXP1     Miyake2023:22716chr3:
71026789-71026789
CTintronicDe novo--Miyake2023 E
FOXP1     M17539chr3:
71247408-71247408
GAexonicMaternalnonsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.C125T
c.C125T
c.C125T
c.C125T
c.C125T
c.C125T
c.C125T
p.P42L
p.P42L
p.P42L
p.P42L
p.P42L
p.P42L
p.P42L
32.08.266E-6Wang2016 T
FOXP1     M02393chr3:
71247423-71247423
GCexonicPaternalnonsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
35.0-Guo2018 T
Wang2016 T
FOXP1     SP0010429chr3:
71101750-71101751
GTGexonicDe novoframeshift deletionNM_001244813
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.147delA
c.453delA
c.447delA
c.447delA
c.447delA
c.447delA
c.447delA
p.K49fs
p.K151fs
p.K149fs
p.K149fs
p.K149fs
p.K149fs
p.K149fs
--Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
FOXP1     M12496chr3:
71247408-71247408
GAexonicMaternalnonsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.C125T
c.C125T
c.C125T
c.C125T
c.C125T
c.C125T
c.C125T
p.P42L
p.P42L
p.P42L
p.P42L
p.P42L
p.P42L
p.P42L
32.08.266E-6Wang2016 T
FOXP1     GX0338.p1chr3:
71247423-71247423
GCexonicMaternalnonsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
35.0-Guo2018 T
FOXP1     M31817chr3:
71247378-71247378
GAexonicMaternalnonsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.C155T
c.C155T
c.C155T
c.C155T
c.C155T
c.C155T
c.C155T
p.A52V
p.A52V
p.A52V
p.A52V
p.A52V
p.A52V
p.A52V
33.02.486E-5Guo2018 T
FOXP1     2-1561-003chr3:
71578502-71578502
TCintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     80001100872chr3:
71027005-71027016
TCTGAGTACCGCTexonicDe novoframeshift deletionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.1011_1021del
c.1083_1093del
c.1317_1327del
c.1311_1321del
c.1311_1321del
c.1311_1321del
c.1311_1321del
c.1311_1321del
p.R337fs
p.R361fs
p.R439fs
p.R437fs
p.R437fs
p.R437fs
p.R437fs
p.R437fs
--Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
FOXP1     GX0065.p1chr3:
71008420-71008420
GCexonicDe novononsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.C1712G
c.C1784G
c.C2018G
c.C2012G
c.C2012G
c.C2009G
c.C2060G
c.C2012G
p.P571R
p.P595R
p.P673R
p.P671R
p.P671R
p.P670R
p.P687R
p.P671R
11.36-Guo2018 T
FOXP1     2-1506-003chr3:
71158995-71159011
TACACACACACACACACTACACACACACACACintronicDe novo--Yuen2017 G
FOXP1     08C74834chr3:
71101750-71101750
GGTexonicDe novoframeshift insertionNM_001244813
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.147dupA
c.453dupA
c.447dupA
c.447dupA
c.447dupA
c.447dupA
c.447dupA
p.Q50fs
p.Q152fs
p.Q150fs
p.Q150fs
p.Q150fs
p.Q150fs
p.Q150fs
--Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
FOXP1     217-14296-4170chr3:
71101750-71101751
GTGTGTexonicDe novoframeshift insertionNM_001244813
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.146_147insAC
c.452_453insAC
c.446_447insAC
c.446_447insAC
c.446_447insAC
c.446_447insAC
c.446_447insAC
p.K49fs
p.K151fs
p.K149fs
p.K149fs
p.K149fs
p.K149fs
p.K149fs
--Stessman2017 T
FOXP1     SP0026093chr3:
71019886-71019886
CCCTGTAAAGCTGCAsplicingDe novosplicing--Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
FOXP1     2-1391-003chr3:
71093290-71093290
GCintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     2-1391-003chr3:
71093110-71093110
TCintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     AU031204chr3:
71425749-71425749
GAintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     GX0296.p1chr3:
71247153-71247153
GTexonicMaternalnonsynonymous SNVNM_001012505c.C247Ap.P83T15.86-Guo2018 T
FOXP1     Hu2022:55chr3:
71015071-71015071
CTexonicUnknownnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.G1559A
c.G1631A
c.G1865A
c.G1859A
c.G1859A
c.G1856A
c.G1907A
c.G1859A
p.S520N
p.S544N
p.S622N
p.S620N
p.S620N
p.S619N
p.S636N
p.S620N
21.7-Hu2022 T
FOXP1     SP0044326chr3:
71021784-71021784
CTexonicDe novononsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_032682
c.G1274A
c.G1346A
c.G1580A
c.G1574A
c.G1574A
c.G1571A
c.G1574A
p.R425Q
p.R449Q
p.R527Q
p.R525Q
p.R525Q
p.R524Q
p.R525Q
28.6-Antaki2022 GE
Trost2022 G
Zhou2022 GE
FOXP1     SP0011684chr3:
71019881-71019889
TCTTACCTGTexonicDe novononframeshift deletionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.1420_1422del
c.1492_1494del
c.1726_1728del
c.1720_1722del
c.1720_1722del
c.1717_1719del
c.1768_1770del
c.1720_1722del
p.474_474del
p.498_498del
p.576_576del
p.574_574del
p.574_574del
p.573_573del
p.590_590del
p.574_574del
--Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
FOXP1     1-0385-003chr3:
71479406-71479406
CAintronicDe novo--Yuen2017 G
FOXP1     11942.p1chr3:
71592594-71592594
CTUTR5Mosaic--Dou2017 E
FOXP1     SP0064489chr3:
71021817-71021817
CTexonicDe novononsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_032682
c.G1241A
c.G1313A
c.G1547A
c.G1541A
c.G1541A
c.G1538A
c.G1541A
p.R414H
p.R438H
p.R516H
p.R514H
p.R514H
p.R513H
p.R514H
23.4-Antaki2022 GE
Trost2022 G
Zhou2022 GE
FOXP1     SP0014949chr3:
71037144-71037144
CTsplicingDe novosplicing20.6-Fu2022 E
Trost2022 G
Zhou2022 GE
FOXP1     200675573@1082035017chr3:
71027145-71027145
GGGACTTexonicDe novoframeshift insertionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.881_882insAAGTC
c.953_954insAAGTC
c.1187_1188insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
p.S294fs
p.S318fs
p.S396fs
p.S394fs
p.S394fs
p.S394fs
p.S394fs
p.S394fs
--Satterstrom2020 E
Trost2022 G
Zhou2022 GE
FOXP1     REACH000189chr3:
71021785-71021785
GAexonicDe novostopgainNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_032682
c.C1273T
c.C1345T
c.C1579T
c.C1573T
c.C1573T
c.C1570T
c.C1573T
p.R425X
p.R449X
p.R527X
p.R525X
p.R525X
p.R524X
p.R525X
38.0-Antaki2022 GE
Trost2022 G
Zhou2022 GE
FOXP1     SSC06364chr3:
71050170-71050170
CCTexonicframeshift insertionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.714dupA
c.786dupA
c.1020dupA
c.1014dupA
c.1014dupA
c.1014dupA
c.1014dupA
c.1014dupA
p.A239fs
p.A263fs
p.A341fs
p.A339fs
p.A339fs
p.A339fs
p.A339fs
p.A339fs
--Antaki2022 GE
FOXP1     SP0028843chr3:
71247280-71247280
CTintronicDe novo--Fu2022 E
FOXP1     SP0077962chr3:
71026868-71026877
TATCTGCTGATexonicDe novoframeshift deletionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.1049_1053del
c.1121_1125del
c.1355_1359del
c.1349_1353del
c.1349_1353del
c.1349_1350del
c.1349_1353del
c.1349_1353del
p.A350fs
p.A374fs
p.A452fs
p.A450fs
p.A450fs
p.D450fs
p.A450fs
p.A450fs
--Antaki2022 GE
Fu2022 E
Zhou2022 GE
FOXP1     SP0080202chr3:
71247426-71247426
CTexonicDe novononsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.G107A
c.G107A
c.G107A
c.G107A
c.G107A
c.G107A
c.G107A
p.R36Q
p.R36Q
p.R36Q
p.R36Q
p.R36Q
p.R36Q
p.R36Q
36.02.479E-5Fu2022 E
Zhou2022 GE
FOXP1     Hu2022:62chr3:
71037180-71037180
CTexonicUnknownnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.G811A
c.G883A
c.G1117A
c.G1111A
c.G1111A
c.G1111A
c.G1111A
c.G1111A
p.V271M
p.V295M
p.V373M
p.V371M
p.V371M
p.V371M
p.V371M
p.V371M
6.736-Hu2022 T
FOXP1     5-0129-003chr3:
71159238-71159238
CTintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     AU4237301chr3:
71100544-71100544
ATintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     1-0032-003chr3:
71376590-71376590
GAintronicDe novo--Yuen2017 G
FOXP1     1-0329-004chr3:
71658089-71658089
CTintergenicDe novo--Yuen2017 G
FOXP1     217-14254-3770chr3:
71050205-71050205
AGexonicUnknownnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.T680C
c.T752C
c.T986C
c.T980C
c.T980C
c.T980C
c.T980C
c.T980C
p.L227P
p.L251P
p.L329P
p.L327P
p.L327P
p.L327P
p.L327P
p.L327P
23.4-Stessman2017 T
FOXP1     Hu2022:83chr3:
71247424-71247424
AGexonicUnknownnonsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.T109C
c.T109C
c.T109C
c.T109C
c.T109C
c.T109C
c.T109C
p.S37P
p.S37P
p.S37P
p.S37P
p.S37P
p.S37P
p.S37P
22.8-Hu2022 T
FOXP1     Cherot2017:2chr3:
71026977-71026977
AGsplicingUnknownsplicing22.0-Cherot2017 E
FOXP1     1-0903-003chr3:
71051577-71051577
TCintronicDe novo--Trost2022 G
FOXP1     SJD_22.3chr3:
71061140-71061140
GAintronicDe novo--Trost2022 G
FOXP1     GX0366.p1chr3:
71247423-71247423
GCexonicUnknownnonsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
35.0-Guo2018 T
FOXP1     D4S2Z-01chr3:
71028485-71028485
TAintronicDe novo--Trost2022 G
FOXP1     MSSNG00243-003chr3:
71046922-71046922
ACintronicDe novo--Trost2022 G
FOXP1     4-0035-003chr3:
71011259-71011259
AGintronicDe novo--Trost2022 G
FOXP1     195485chr3:
71179778-71179789
TAAACAGGAAGTTexonicMaternalframeshift deletionNM_001244815c.46_56delp.T16fs--Stessman2017 T
FOXP1     5-5035-003chr3:
71028466-71028466
AGintronicDe novo--Trost2022 G
FOXP1     AU3586303chr3:
71117741-71117741
GAintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     7-0294-003chr3:
71009631-71009631
GAintronicDe novo--Trost2022 G
FOXP1     Mahjani2021:106chr3:
71026184-71026184
CTexonicnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.G1138A
c.G1210A
c.G1444A
c.G1438A
c.G1438A
c.G1435A
c.G1438A
c.G1438A
p.E380K
p.E404K
p.E482K
p.E480K
p.E480K
p.E479K
p.E480K
p.E480K
25.7-Mahjani2021 E
FOXP1     MSSNG00379-003chr3:
71169751-71169751
ACintronicDe novo--Trost2022 G
FOXP1     SP0049648chr3:
71179609-71179609
ACintronicDe novo--Trost2022 G
FOXP1     AU2817301chr3:
71147880-71147880
CGintronicDe novo--Trost2022 G
FOXP1     M01483chr3:
71015120-71015120
CTexonicMaternalnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.G1510A
c.G1582A
c.G1816A
c.G1810A
c.G1810A
c.G1807A
c.G1858A
c.G1810A
p.E504K
p.E528K
p.E606K
p.E604K
p.E604K
p.E603K
p.E620K
p.E604K
36.0-Guo2018 T
Wang2016 T
FOXP1     2-1333-003chr3:
71161284-71161284
TGintronicDe novo--Trost2022 G
FOXP1     1-0681-003chr3:
71097820-71097820
TCintronicDe novo--Trost2022 G
FOXP1     AU2448301chr3:
71111044-71111044
AGintronicDe novo--Trost2022 G
FOXP1     MSSNG00404-003chr3:
71087659-71087659
TCintronicDe novo--Trost2022 G
FOXP1     MSSNG00031-004chr3:
71090291-71090291
CTintronicDe novo--Trost2022 G
FOXP1     4-0075-003chr3:
71201236-71201237
TAGGintronicDe novo--Trost2022 G
FOXP1     5-5065-003chr3:
71206393-71206393
GAintronicDe novo--Trost2022 G
FOXP1     1-0838-003chr3:
71189639-71189639
TGintronicDe novo--Trost2022 G
FOXP1     1029chr3:
71198768-71198771
ATTTAintronicDe novo--Trost2022 G
FOXP1     Mahjani2021:110chr3:
71027005-71027016
TCTGAGTACCGCTexonicframeshift deletionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.1011_1021del
c.1083_1093del
c.1317_1327del
c.1311_1321del
c.1311_1321del
c.1311_1321del
c.1311_1321del
c.1311_1321del
p.R337fs
p.R361fs
p.R439fs
p.R437fs
p.R437fs
p.R437fs
p.R437fs
p.R437fs
--Mahjani2021 E
FOXP1     SP0086689chr3:
71179609-71179609
ACintronicDe novo--Trost2022 G
FOXP1     SP0098529chr3:
71179609-71179609
ACintronicDe novo--Trost2022 G
FOXP1     SP0087397chr3:
71179609-71179609
ACintronicDe novo--Trost2022 G
FOXP1     SP0140190chr3:
71179609-71179609
ACintronicDe novo--Trost2022 G
FOXP1     F10016-1chr3:
71021818-71021818
GAexonicDe novononsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_032682
c.C1240T
c.C1312T
c.C1546T
c.C1540T
c.C1540T
c.C1537T
c.C1540T
p.R414C
p.R438C
p.R516C
p.R514C
p.R514C
p.R513C
p.R514C
21.4-Satterstrom2020 E
Trost2022 G
Zhou2022 GE
FOXP1     MSSNG00066-003chr3:
71286155-71286155
CTintronicDe novo--Trost2022 G
FOXP1     SSC00370chr3:
71026115-71026115
GAexonicDe novostopgainNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.C1207T
c.C1279T
c.C1513T
c.C1507T
c.C1507T
c.C1504T
c.C1507T
c.C1507T
p.R403X
p.R427X
p.R505X
p.R503X
p.R503X
p.R502X
p.R503X
p.R503X
37.0-Fu2022 E
Lim2017 E
Trost2022 G
FOXP1     3-0668-000chr3:
71303583-71303583
CTintronicDe novo--Trost2022 G
FOXP1     2-1093-009chr3:
71484353-71484353
GGGGAintronicDe novo--Yuen2017 G
FOXP1     1-1036-003chr3:
71264628-71264628
GAintronicDe novo--Trost2022 G
FOXP1     2-1787-003chr3:
71277006-71277006
GTintronicDe novo--Trost2022 G
FOXP1     2-1148-004chr3:
71337579-71337579
AGintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     2-1261-004chr3:
71242599-71242599
GCCTTTGTTTGTTGTTGTTGTTGTTGTTGTintronicDe novo--Trost2022 G
FOXP1     MSSNG00061-003chr3:
71249861-71249861
GCintronicDe novo--Trost2022 G
FOXP1     G01-GEA-36-HIchr3:
71021817-71021817
CTexonicDe novononsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_032682
c.G1241A
c.G1313A
c.G1547A
c.G1541A
c.G1541A
c.G1538A
c.G1541A
p.R414H
p.R438H
p.R516H
p.R514H
p.R514H
p.R513H
p.R514H
23.4-Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
FOXP1     14-600chr3:
71208056-71208056
GCintronicDe novo--Trost2022 G
FOXP1     2-1481-003chr3:
71229143-71229143
TCintronicDe novo--Trost2022 G
FOXP1     7-0249-004chr3:
71384745-71384745
TCintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     2-1686-003chr3:
71602828-71602831
GAACGintronicDe novo--Trost2022 G
FOXP1     2-0295-003chr3:
71606662-71606662
GAintronicDe novo--Trost2022 G
FOXP1     1-0018-004chr3:
71572496-71572497
CATTintronicDe novo--Trost2022 G
FOXP1     F1561-1chr3:
71096108-71096108
GAexonicDe novostopgainNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.C349T
c.C421T
c.C655T
c.C649T
c.C649T
c.C649T
c.C649T
c.C649T
p.Q117X
p.Q141X
p.Q219X
p.Q217X
p.Q217X
p.Q217X
p.Q217X
p.Q217X
37.0-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
FOXP1     1-1154-003chr3:
71587572-71587572
GAintronicDe novo--Trost2022 G
FOXP1     M13295chr3:
71247198-71247198
GTexonicPaternalnonsynonymous SNVNM_001012505c.C202Ap.P68T12.29-Guo2018 T
FOXP1     7-0347-003chr3:
71525461-71525461
TGintronicDe novo--Trost2022 G
FOXP1     M19747chr3:
71015168-71015168
CTexonicPaternalnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.G1462A
c.G1534A
c.G1768A
c.G1762A
c.G1762A
c.G1759A
c.G1810A
c.G1762A
p.A488T
p.A512T
p.A590T
p.A588T
p.A588T
p.A587T
p.A604T
p.A588T
22.73.0E-4Guo2018 T
FOXP1     2-1519-003chr3:
71554358-71554358
CTintronicDe novo--Trost2022 G
FOXP1     3-0497-000chr3:
71323816-71323819
GATAGintronicDe novo--Trost2022 G
FOXP1     3-0399-000chr3:
71037144-71037144
CTsplicingUnknownsplicing20.6-Chan2022 G
FOXP1     MSSNG00021-004chr3:
71456065-71456065
ATintronicDe novo--Trost2022 G
FOXP1     2-0135-003chr3:
71086862-71086862
GAintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     Stessman2017:ASD_1287-1chr3:
71015108-71015108
CTexonicUnknownnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.G1522A
c.G1594A
c.G1828A
c.G1822A
c.G1822A
c.G1819A
c.G1870A
c.G1822A
p.G508R
p.G532R
p.G610R
p.G608R
p.G608R
p.G607R
p.G624R
p.G608R
35.01.647E-5Stessman2017 T
FOXP1     REACH000747chr3:
71629158-71629164
TTCTGCATintronicDe novo--Trost2022 G
FOXP1     AU2129301chr3:
71191380-71191380
AGintronicDe novo--Trost2022 G
Yuen2017 G
FOXP1     1-0548-003chr3:
71613055-71613055
GAintronicDe novo--Trost2022 G
FOXP1     AU2186301chr3:
71628383-71628383
GGAintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More