or
or
Exact

Results for "DEAF1"

Variant Events: 37

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DEAF1     SP0006987chr11:
686922-686922
GAexonicDe novononsynonymous SNVNM_021008c.C740Tp.A247V31.0-Fu2022 E
Trost2022 G
Zhou2022 GE
DEAF1     SP0116249chr11:
694967-694985
CGCCGCCACAGCGGCCGCGCexonicnonframeshift deletionNM_001293634
NM_021008
c.63_80del
c.63_80del
p.21_27del
p.21_27del
--Zhou2022 GE
DEAF1     11563_p1chr11:
679719-679719
CTexonicDe novosynonymous SNVNM_001293634
NM_021008
c.G828A
c.G1095A
p.P276P
p.P365P
--Fu2022 E
DEAF1     SP0139210chr11:
687941-687941
CTexonicDe novononsynonymous SNVNM_001293634
NM_021008
c.G634A
c.G634A
p.G212S
p.G212S
34.0-Fu2022 E
Trost2022 G
Zhou2022 GE
DEAF1     Chen2021:4chr11:
686992-686992
GAexonicDe novononsynonymous SNVNM_021008c.C670Tp.R224W16.45-Chen2021 GET
DEAF1     140596chr11:
687955-687955
CTexonicDe novononsynonymous SNVNM_001293634
NM_021008
c.G620A
c.G620A
p.C207Y
p.C207Y
25.7-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
DEAF1     A1328Bchr11:
684943-684943
GTexonicDe novononsynonymous SNVNM_001293634
NM_021008
c.C685A
c.C825A
p.R229S
p.H275Q
17.19-Fu2022 E
DEAF1     GEA488chr11:
686992-686992
GAexonicDe novononsynonymous SNVNM_021008c.C670Tp.R224W16.45-Fu2022 E
DEAF1     3-0345-001chr11:
681257-681257
GAintronicDe novo--Trost2022 G
DEAF1     MSSNG00363-003chr11:
691231-691231
GAintronicDe novo--Trost2022 G
DEAF1     7-0351-003chr11:
672042-672042
GAintronicDe novo--Trost2022 G
DEAF1     F10023-1chr11:
686950-686950
TGexonicDe novononsynonymous SNVNM_021008c.A712Cp.T238P16.08-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
DEAF1     Chen2021:5chr11:
686992-686992
GAexonicDe novononsynonymous SNVNM_021008c.C670Tp.R224W16.45-Chen2021 GET
DEAF1     SP0006987chr11:
680904-680904
GCintronicDe novo--Trost2022 G
DEAF1     Wang2023:126chr11:
686904-686904
TAexonicDe novononsynonymous SNVNM_021008c.A758Tp.K253I29.0-Wang2023 E
DEAF1     AU4286302chr11:
647806-647806
AGintronicDe novo--Trost2022 G
DEAF1     MSSNG00343-003chr11:
660941-660941
CTintronicDe novo--Trost2022 G
DEAF1     Husson2020:30chr11:
686991-686991
CTexonicnonsynonymous SNVNM_021008c.G671Ap.R224Q18.37-Husson2020 E
DEAF1     Gupta2023:Family1chr11:
686988-686988
CAexonicDe novononsynonymous SNVNM_021008c.G674Tp.G225V15.21-Gupta2023 E
DEAF1     ASDFI_979chr11:
687917-687917
CTexonicDe novononsynonymous SNVNM_001293634
NM_021008
c.G658A
c.G658A
p.G220S
p.G220S
33.08.264E-6DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
DEAF1     AU086Achr11:
687919-687919
AGexonicDe novononsynonymous SNVNM_001293634
NM_021008
c.T656C
c.T656C
p.L219P
p.L219P
21.0-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
DEAF1     09C82675chr11:
688377-688377
GAexonicDe novosynonymous SNVNM_001293634
NM_021008
c.C471T
c.C471T
p.I157I
p.I157I
--DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
DEAF1     2-1508-004chr11:
677912-677912
GAintronicDe novo--Yuen2017 G
DEAF1     561320chr11:
686925-686925
CGexonicDe novononsynonymous SNVNM_021008c.G737Cp.R246T23.3-Chen2017a T
DEAF1     11563.p1chr11:
679719-679719
CTexonicDe novosynonymous SNVNM_001293634
NM_021008
c.G828A
c.G1095A
p.P276P
p.P365P
--Iossifov2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Wilfert2021 G
Zhou2022 GE
DEAF1     M2647chr11:
686962-686962
ATexonicDe novononsynonymous SNVNM_021008c.T700Ap.W234R17.98-Chen2017a T
DEAF1     538820chr11:
681047-681050
TCTTTexonicDe novononframeshift deletionNM_021008c.910_912delp.304_304del--Chen2017a T
DEAF1     563832chr11:
686871-686871
TGexonicDe novononsynonymous SNVNM_021008c.A791Cp.Q264P17.12-Chen2017a T
DEAF1     80001100871chr11:
687927-687927
CAexonicDe novononsynonymous SNVNM_001293634
NM_021008
c.G648T
c.G648T
p.K216N
p.K216N
19.33-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
DEAF1     597158chr11:
687941-687941
CTexonicDe novononsynonymous SNVNM_001293634
NM_021008
c.G634A
c.G634A
p.G212S
p.G212S
34.0-Chen2017a T
DEAF1     Chen2021:54chr11:
687967-687967
AGexonicDe novononsynonymous SNVNM_001293634
NM_021008
c.T608C
c.T608C
p.L203P
p.L203P
24.3-Chen2021 GET
DEAF1     Chen2021:55chr11:
684943-684943
GCexonicDe novononsynonymous SNVNM_001293634
NM_021008
c.C685G
c.C825G
p.R229G
p.H275Q
16.96-Chen2021 GET
DEAF1     SP0132364chr11:
679798-679798
CTexonicnonsynonymous SNVNM_001293634
NM_021008
c.G749A
c.G1016A
p.G250E
p.G339E
15.17-Zhou2022 GE
DEAF1     Hu2022:15chr11:
687941-687941
CTexonicMaternalnonsynonymous SNVNM_001293634
NM_021008
c.G634A
c.G634A
p.G212S
p.G212S
34.0-Hu2022 T
DEAF1     SP0341078chr11:
687978-687978
GCexonicstopgainNM_001293634
NM_021008
c.C597G
c.C597G
p.Y199X
p.Y199X
40.0-Zhou2022 GE
DEAF1     AU3124302chr11:
686881-686881
GAexonicPaternalstopgainNM_021008c.C781Tp.R261X36.08.27E-6Cirnigliaro2023 G
DEAF1     12795.p1chr11:
682518-682518
ATintronicDe novo--Turner2016 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More