or
or
Exact

Results for "CRY1"

Variant Events: 19

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CRY1     AU4467302chr12:
107399459-107399459
AGintronicDe novo--Yuen2017 G
CRY1     2-1645-003chr12:
107565096-107565096
TGintergenicDe novo--Yuen2017 G
CRY1     2-0296-004chr12:
107681875-107681875
CTintergenicDe novo--Yuen2017 G
CRY1     1-0300-004chr12:
107403329-107403329
AAAAACintronicDe novo--Yuen2017 G
CRY1     345-05-104725chr12:
107395700-107395700
GAexonicDe novononsynonymous SNVNM_004075c.C437Tp.P146L17.992.481E-5Satterstrom2020 E
CRY1     AU4372309chr12:
107487743-107487743
CGupstreamDe novo--Yuen2017 G
CRY1     7-0106-003chr12:
107418356-107418356
CAintronicDe novo--Yuen2017 G
CRY1     2-1346-003chr12:
107577041-107577041
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
CRY1     AU2139301chr12:
107647961-107647961
CTintergenicDe novo--Yuen2017 G
CRY1     1-0358-003chr12:
107411696-107411696
CGintronicDe novo--Yuen2017 G
CRY1     AU4479301chr12:
107659629-107659629
CTintergenicDe novo--Yuen2017 G
CRY1     12175.p1chr12:
107434712-107434712
GAintronicDe novo--Turner2016 G
CRY1     2-0088-003chr12:
107533188-107533188
CTintergenicDe novo--Yuen2017 G
CRY1     7-0100-004chr12:
107691497-107691497
GAintergenicDe novo--Yuen2017 G
CRY1     2-1454-003chr12:
107674807-107674831
CATTTATTTATTTATTTATTTATTTCATTTATTTATTTATTTATTTintergenicDe novo--Yuen2017 G
CRY1     AU2433302chr12:
107415513-107415513
TCintronicDe novo--Yuen2017 G
CRY1     Al-Mubarak2017:ASD-17chr12:
107399022-107399022
CTexonicUnknownstopgainNM_004075c.G272Ap.W91X45.0-Al-Mubarak2017 E
CRY1     AU003405chr12:
107623226-107623226
CTintergenicDe novo--Yuen2017 G
CRY1     AU2433302chr12:
107432378-107432378
TAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More