or
or
Exact

Results for "NRXN1"

Variant Events: 236

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NRXN1     AU4452302chr2:
52903523-52903523
GAintergenicDe novo--Yuen2017 G
NRXN1     AU1355301chr2:
52832144-52832144
CTintergenicDe novo--Yuen2017 G
NRXN1     10-05671chr2:
50765556-50765556
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G1978A
c.G2098A
p.A660T
p.A700T
34.06.625E-5Wang2020 T
NRXN1     AU3760302chr2:
50376489-50376489
GAintronicDe novo--Yuen2017 G
NRXN1     Husson2020:307chr2:
50850520-50850521
CCCexonicframeshift deletionNM_004801
NM_001135659
c.1065delG
c.1164delG
p.V355fs
p.V388fs
--Husson2020 E
NRXN1     AU3808305chr2:
52237178-52237178
TCintergenicDe novo--Yuen2017 G
NRXN1     AU1165302chr2:
50733684-50733684
GAexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.C2446T
c.C2566T
p.R816W
p.R856W
20.81.706E-5Wang2020 T
Wang2020 T
Wang2020 T
NRXN1     M27849chr2:
51255153-51255153
CAexonicUnknownnonsynonymous SNVNM_001135659
NM_004801
c.G259T
c.G259T
p.G87C
p.G87C
25.1-Wang2020 T
Wang2020 T
NRXN1     GD0072.p1chr2:
50149288-50149288
CTexonicUnknownnonsynonymous SNVNM_138735
NM_004801
NM_001135659
c.G1123A
c.G4228A
c.G4438A
p.A375T
p.A1410T
p.A1480T
25.98.239E-6Wang2020 T
Wang2020 T
NRXN1     03C23225chr2:
50733684-50733684
GAexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.C2446T
c.C2566T
p.R816W
p.R856W
20.81.706E-5Wang2020 T
Wang2020 T
NRXN1     AU070007chr2:
52713939-52713939
TGintergenicDe novo--Yuen2017 G
NRXN1     HN0187.p1chr2:
50282131-50282131
CAexonicUnknownnonsynonymous SNVNM_001135659c.G3890Tp.R1297L18.47-Wang2020 T
Wang2020 T
NRXN1     SX0028.p1chr2:
50758386-50758393
CACGTCCTGexonicUnknownframeshift substitutionNM_004801
NM_001135659
c.2319_2326C
c.2439_2446C
N/A
N/A
--Wang2020 T
Wang2020 T
NRXN1     SX0080.p1chr2:
50724511-50724511
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G2839A
c.G2959A
p.G947R
p.G987R
32.0-Wang2020 T
Wang2020 T
NRXN1     SD0017.p1chr2:
50723223-50723223
ATexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.T2890A
c.T3010A
p.Y964N
p.Y1004N
23.1-Wang2020 T
Wang2020 T
NRXN1     HEN0045.p1chr2:
50724852-50724852
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G2498A
c.G2618A
p.G833D
p.G873D
28.9-Wang2020 T
Wang2020 T
NRXN1     06C61542chr2:
50765556-50765556
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G1978A
c.G2098A
p.A660T
p.A700T
34.06.625E-5Wang2020 T
NRXN1     1-0534-006chr2:
50969632-50969632
GAintronicDe novo--Yuen2017 G
NRXN1     07C62631chr2:
50765556-50765556
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G1978A
c.G2098A
p.A660T
p.A700T
34.06.625E-5Wang2020 T
NRXN1     AU1616315chr2:
50765556-50765556
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G1978A
c.G2098A
p.A660T
p.A700T
34.06.625E-5Wang2020 T
NRXN1     Husson2020::98chr2:
50464056-50464057
CCCexonicDe novoframeshift deletionNM_138735
NM_004801
NM_001135659
c.311delG
c.3416delG
c.3536delG
p.W104fs
p.W1139fs
p.W1179fs
--Husson2020 E
NRXN1     M23182chr2:
50724852-50724852
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G2498A
c.G2618A
p.G833D
p.G873D
28.9-Wang2020 T
Wang2020 T
Wang2020 T
NRXN1     AU4426303chr2:
50542180-50542180
CGintronicDe novo--Yuen2017 G
NRXN1     1-0338-005chr2:
50929083-50929083
GAintronicDe novo--Yuen2017 G
NRXN1     1-0652-004chr2:
50324588-50324588
GAintronicDe novo--Yuen2017 G
NRXN1     2-1620-003chr2:
50277024-50277024
TGintronicDe novo--Yuen2017 G
NRXN1     AU1640302chr2:
51641587-51641587
TGintergenicDe novo--Yuen2017 G
NRXN1     AU061104 Complex Event; expand row to view variants  Unknown, Inheritedframeshift deletionNM_004801
NM_001135659
NM_004801
NM_001135659
c.2365_2366del
c.2485_2486del
c.2366_2367del
c.2486_2487del
p.C789fs
p.C829fs
p.C789fs
p.C829fs
--Stessman2017 T
Wang2020 T
Wang2020 T
NRXN1     AU079104chr2:
51819111-51819111
AGintergenicDe novo--Yuen2017 G
NRXN1     7-0160-003chr2:
51493127-51493127
AGintergenicDe novo--Yuen2017 G
NRXN1     2-1431-003chr2:
50906082-50906082
GAintronicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     SSC04927chr2:
50724605-50724605
ATexonicDe novostopgainNM_004801
NM_001135659
c.T2745A
c.T2865A
p.Y915X
p.Y955X
49.0-Lim2017 E
NRXN1     2-1431-003chr2:
50915714-50915714
GCintronicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     1-0531-003chr2:
52829160-52829160
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     Li2017:23778chr2:
50692611-50692611
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G3333A
c.G3453A
p.M1111I
p.M1151I
24.8-Li2017 T
NRXN1     2-1431-003chr2:
50937891-50937891
TCintronicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     1-0485-003chr2:
52606458-52606461
TACATAintergenicDe novo--Yuen2017 G
NRXN1     1-0184-003chr2:
51970389-51970406
CAGAGAGAGAGAGAGAGACAGAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
NRXN1     1-0559-004chr2:
51353766-51353766
TAintergenicDe novo--Yuen2017 G
NRXN1     2-0264-004chr2:
51285668-51285668
CAintergenicDe novo--Yuen2017 G
NRXN1     AU4176302chr2:
52665542-52665542
GCintergenicDe novo--Yuen2017 G
NRXN1     7-0254-004chr2:
52853682-52853682
GAintergenicDe novo--Yuen2017 G
NRXN1     1-0572-003chr2:
50490235-50490235
GAintronicDe novo--Yuen2017 G
NRXN1     5-0140-003chr2:
50965472-50965472
TGintronicDe novo--Yuen2017 G
NRXN1     1-0265-003chr2:
52629760-52629760
GCintergenicDe novo--Yuen2017 G
NRXN1     2-0022-003chr2:
50306068-50306068
GAintronicDe novo--Yuen2017 G
NRXN1     12060.p1chr2:
51259257-51259258
CGCUTR5De novo--Werling2018 G
Wilfert2021 G
NRXN1     AU075703chr2:
52388399-52388399
CTintergenicDe novo--Yuen2017 G
NRXN1     iHART1890chr2:
50780064-50780064
CAexonicPaternalstopgainNM_004801
NM_001135659
c.G1420T
c.G1540T
p.E474X
p.E514X
49.0-Ruzzo2019 G
NRXN1     2-1244-003chr2:
52211719-52211719
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     2-1244-003chr2:
52723344-52723344
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     iHART1889chr2:
50780064-50780064
CAexonicPaternalstopgainNM_004801
NM_001135659
c.G1420T
c.G1540T
p.E474X
p.E514X
49.0-Ruzzo2019 G
NRXN1     2-1620-004chr2:
51089213-51089213
GAintronicDe novo--Yuen2017 G
NRXN1     2-1207-003chr2:
52690587-52690587
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     B8Z4Fchr2:
50692579-50692579
CTsplicingUnknown, Inheritedsplicing22.5-Stessman2017 T
Wang2020 T
Wang2020 T
NRXN1     AU3964302chr2:
50497740-50497740
GAintronicDe novo--Yuen2017 G
NRXN1     1-0144-004chr2:
51365245-51365245
AGintergenicDe novo--Yuen2017 G
NRXN1     2-1460-003chr2:
51947621-51947621
TCintergenicDe novo--Yuen2017 G
NRXN1     1-0465-003chr2:
52058679-52058679
CTintergenicDe novo--Yuen2017 G
NRXN1     AU4235301chr2:
52477997-52477997
TCintergenicDe novo--Yuen2017 G
NRXN1     12501.p1chr2:
50724605-50724605
ATexonicDe novostopgainNM_004801
NM_001135659
c.T2745A
c.T2865A
p.Y915X
p.Y955X
49.0-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
Willsey2013 E
NRXN1     AU3724301chr2:
50450690-50450690
CTintronicDe novo--Yuen2017 G
NRXN1     2-1440-003chr2:
51925281-51925281
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     A31chr2:
50870593-50870593
CGintronicDe novo--Wu2018 G
NRXN1     AU3786301chr2:
51009138-51009138
GAintronicDe novo--Yuen2017 G
NRXN1     211-5211-3chr2:
50464021-50464021
CAexonicUnknownnonsynonymous SNVNM_138735
NM_004801
NM_001135659
c.G347T
c.G3452T
c.G3572T
p.R116I
p.R1151I
p.R1191I
35.0-Wang2020 T
Wang2020 T
NRXN1     AU2951303chr2:
50817801-50817801
CTintronicDe novo--Yuen2017 G
NRXN1     2-1406-003chr2:
51689092-51689092
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     AU2054301chr2:
50149217-50149217
GCexonicUnknownstopgainNM_138735
NM_004801
NM_001135659
c.C1194G
c.C4299G
c.C4509G
p.Y398X
p.Y1433X
p.Y1503X
49.0-Wang2020 T
Wang2020 T
NRXN1     1-0279-004chr2:
50635125-50635125
AGintronicDe novo--Yuen2017 G
NRXN1     5-0004-003chr2:
52673928-52673928
GTintergenicDe novo--Yuen2017 G
NRXN1     210-18164-301chr2:
50149217-50149217
GCexonicUnknownstopgainNM_138735
NM_004801
NM_001135659
c.C1194G
c.C4299G
c.C4509G
p.Y398X
p.Y1433X
p.Y1503X
49.0-Wang2020 T
Wang2020 T
Wang2020 T
NRXN1     AU3680301chr2:
50683158-50683158
AGintronicDe novo--Yuen2017 G
NRXN1     AU3858302chr2:
51378469-51378469
CTintergenicDe novo--Yuen2017 G
NRXN1     61188249chr2:
50758565-50758565
GTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.C2147A
c.C2267A
p.A716E
p.A756E
33.0-Wang2020 T
Wang2020 T
NRXN1     60372238chr2:
50758442-50758442
GAexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.C2270T
c.C2390T
p.A757V
p.A797V
36.0-Wang2020 T
Wang2020 T
NRXN1     M23715chr2:
50724685-50724685
CTexonicMaternalnonsynonymous SNVNM_004801
NM_001135659
c.G2665A
c.G2785A
p.D889N
p.D929N
35.0-Guo2018 T
Wang2016 T
NRXN1     1-0452-003chr2:
52302220-52302220
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     402553chr2:
50779724-50779724
CTsplicingUnknownsplicing21.0-Wang2020 T
Wang2020 T
NRXN1     2-1451-004chr2:
50345418-50345418
TCintronicDe novo--Yuen2017 G
NRXN1     217-14288-4090 Complex Event; expand row to view variants  De novoframeshift deletionNM_138735
NM_004801
NM_001135659
NM_138735
NM_004801
NM_001135659
c.996delC
c.4101delC
c.4311delC
c.995delC
c.4100delC
c.4310delC
p.P332fs
p.P1367fs
p.P1437fs
p.P332fs
p.P1367fs
p.P1437fs
--O’Roak2014 T
Stessman2017 T
Stessman2017 T
Wang2020 T
Wang2020 T
NRXN1     1-0901-003chr2:
52338673-52338673
CGintergenicDe novo--Yuen2017 G
NRXN1     2-0022-004chr2:
50678167-50678167
GAintronicDe novo--Yuen2017 G
NRXN1     74-0352chr2:
52580360-52580360
ATintergenicDe novo--Michaelson2012 G
NRXN1     2-1297-004chr2:
51083088-51083088
TCintronicDe novo--Yuen2017 G
NRXN1     AU3154302chr2:
52160245-52160245
AGintergenicDe novo--Yuen2017 G
NRXN1     AU0614312chr2:
50463973-50463973
CTexonicUnknownnonsynonymous SNVNM_138735
NM_004801
NM_001135659
c.G395A
c.G3500A
c.G3620A
p.R132Q
p.R1167Q
p.R1207Q
33.01.657E-5Wang2020 T
Wang2020 T
Wang2020 T
NRXN1     2-1497-003chr2:
50656695-50656695
AGintronicDe novo--Yuen2017 G
NRXN1     AU002406chr2:
52179326-52179326
TCintergenicDe novo--Yuen2017 G
NRXN1     M26820chr2:
50733677-50733677
CTexonicMaternalnonsynonymous SNVNM_004801
NM_001135659
c.G2453A
c.G2573A
p.G818E
p.G858E
33.0-Guo2018 T
Wang2016 T
Wang2020 T
Wang2020 T
NRXN1     1-0559-005chr2:
50318312-50318312
CGintronicDe novo--Yuen2017 G
NRXN1     AU0614212chr2:
50463973-50463973
CTexonicUnknownnonsynonymous SNVNM_138735
NM_004801
NM_001135659
c.G395A
c.G3500A
c.G3620A
p.R132Q
p.R1167Q
p.R1207Q
33.01.657E-5Wang2020 T
Wang2020 T
NRXN1     1-0339-004chr2:
51843463-51843463
AGintergenicDe novo--Yuen2017 G
NRXN1     3-0431-000chr2:
52126740-52126740
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     BK742-01chr2:
50699460-50699460
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G3220A
c.G3340A
p.G1074R
p.G1114R
33.0-Wang2020 T
Wang2020 T
NRXN1     AU3702307chr2:
51973646-51973646
TAintergenicDe novo--Yuen2017 G
NRXN1     AU4228302chr2:
50162790-50162790
CAintronicDe novo--Yuen2017 G
NRXN1     1-0265-004chr2:
52629760-52629760
GCintergenicDe novo--Yuen2017 G
NRXN1     2-1343-003chr2:
50801767-50801767
CAintronicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     1-0402-004chr2:
51153293-51153293
GCintronicDe novo--Yuen2017 G
NRXN1     1-0465-003achr2:
52058679-52058679
CTintergenicDe novo--Yuen2017 G
NRXN1     138chr2:
50280477-50280477
TAexonicPaternalnonsynonymous SNVNM_138735
NM_004801
NM_001135659
c.A865T
c.A3970T
c.A4180T
p.T289S
p.T1324S
p.T1394S
20.22.0E-4Wen2017 E
NRXN1     A1chr2:
52516954-52516954
CAintergenicDe novo--Wu2018 G
NRXN1     7-0143-003chr2:
50638627-50638627
CGintronicDe novo--Yuen2017 G
NRXN1     386431chr2:
50758537-50758537
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G2175A
c.G2295A
p.M725I
p.M765I
34.0-Wang2020 T
Wang2020 T
Wang2020 T
Wang2020 T
NRXN1     84840610chr2:
50779730-50779730
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G1754A
c.G1874A
p.R585Q
p.R625Q
33.0-Wang2020 T
Wang2020 T
Wang2020 T
Wang2020 T
NRXN1     M02443chr2:
50724685-50724685
CTexonicPaternalnonsynonymous SNVNM_004801
NM_001135659
c.G2665A
c.G2785A
p.D889N
p.D929N
35.0-Guo2018 T
Wang2016 T
NRXN1     3-0434-000chr2:
51932157-51932157
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     2-1507-003chr2:
50386109-50386109
CTintronicDe novo--Yuen2017 G
NRXN1     AU2863303chr2:
51512074-51512074
AGintergenicDe novo--Yuen2017 G
NRXN1     2-1066-004chr2:
51551133-51551133
ATintergenicDe novo--Yuen2017 G
NRXN1     69532182chr2:
50779730-50779730
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G1754A
c.G1874A
p.R585Q
p.R625Q
33.0-Wang2020 T
Wang2020 T
NRXN1     70845110chr2:
50758537-50758537
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G2175A
c.G2295A
p.M725I
p.M765I
34.0-Wang2020 T
Wang2020 T
NRXN1     2-1315-003chr2:
51585814-51585814
CTintergenicDe novo--Yuen2017 G
NRXN1     2-1116-003chr2:
50724817-50724817
GAexonicInheritednonsynonymous SNVNM_004801
NM_001135659
c.C2533T
c.C2653T
p.H845Y
p.H885Y
32.06.0E-4Jiang2013 G
NRXN1     7-0248-003chr2:
51371191-51371191
GCintergenicDe novo--Yuen2017 G
NRXN1     AU1988301chr2:
51128158-51128158
GAintronicDe novo--Yuen2017 G
NRXN1     2-1352-003chr2:
51797440-51797440
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     AU2089302chr2:
52928210-52928210
TCintergenicDe novo--Yuen2017 G
NRXN1     1-0565-004chr2:
51476580-51476580
TAintergenicDe novo--Yuen2017 G
NRXN1     AU4243302chr2:
51473877-51473877
GCintergenicDe novo--Yuen2017 G
NRXN1     13557.p1chr2:
50562721-50562721
GAintronicDe novo--Wilfert2021 G
NRXN1     M26879 Complex Event; expand row to view variants  Maternalframeshift deletion, frameshift substitutionNM_004801
NM_001135659
NM_004801
NM_001135659
c.2898delT
c.3018delT
c.2898_2899A
c.3018_3019A
p.F966fs
p.F1006fs
N/A
N/A
--Guo2018 T
Wang2016 T
Wang2020 T
Wang2020 T
NRXN1     2-1170-003chr2:
51215643-51215643
CTintronicDe novo--Yuen2017 G
NRXN1     1-0565-004chr2:
52409700-52409700
TTGTAAintergenicDe novo--Yuen2017 G
NRXN1     2-0102-003chr2:
52170820-52170820
GTintergenicDe novo--Yuen2017 G
NRXN1     AU4231301chr2:
51724931-51724931
AGintergenicDe novo--Yuen2017 G
NRXN1     1-0226-005chr2:
52687953-52687953
AGintergenicDe novo--Yuen2017 G
NRXN1     11474.p1chr2:
50703434-50703434
AGintronicDe novo--Wilfert2021 G
NRXN1     13823.p1chr2:
50624886-50624886
ACintronicDe novo--Wilfert2021 G
NRXN1     1-0609-003chr2:
50864033-50864033
TCintronicDe novo--Yuen2017 G
NRXN1     12799.p1chr2:
52886862-52886866
TTGCAGTGCCintergenicMaternal--Wilfert2021 G
NRXN1     1-0277-003chr2:
51514052-51514052
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     AU3632301chr2:
52839347-52839347
TCintergenicDe novo--Yuen2017 G
NRXN1     08C73161chr2:
51254748-51254748
CAexonicDe novostopgainNM_001135659
NM_004801
c.G664T
c.G664T
p.E222X
p.E222X
47.0-Satterstrom2020 E
NRXN1     AU031203chr2:
52601722-52601729
AAAAGAAAAAAAintergenicDe novo--Yuen2017 G
NRXN1     7-0077-003chr2:
50919107-50919107
TAintronicDe novo--Yuen2017 G
NRXN1     AU030103chr2:
51972268-51972268
AGintergenicDe novo--Yuen2017 G
NRXN1     7-0055-003chr2:
52078634-52078634
CTintergenicDe novo--Yuen2017 G
NRXN1     7-0055-003chr2:
52078636-52078636
AGintergenicDe novo--Yuen2017 G
NRXN1     AU4269301chr2:
50606609-50606609
CTintronicDe novo--Yuen2017 G
NRXN1     1-0534-003chr2:
50969632-50969632
GAintronicDe novo--Yuen2017 G
NRXN1     DEASD_0107_001chr2:
50318536-50318536
CTexonicDe novononsynonymous SNVNM_138735
NM_004801
NM_001135659
c.G538A
c.G3643A
c.G3763A
p.V180I
p.V1215I
p.V1255I
20.1-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Wang2020 T
NRXN1     NDAR_INVCG000TG1_wes1chr2:
50850511-50850511
TGexonicDe novononsynonymous SNVNM_004801
NM_001135659
c.A1075C
c.A1174C
p.N359H
p.N392H
18.45-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Wang2020 T
NRXN1     2-0135-004chr2:
50813838-50813838
GAintronicDe novo--Yuen2017 G
NRXN1     AU3703302chr2:
52787724-52787724
TCintergenicDe novo--Yuen2017 G
NRXN1     2-1508-003chr2:
52739191-52739191
TAintergenicDe novo--Yuen2017 G
NRXN1     AU3052302chr2:
50514188-50514188
GAintronicDe novo--Yuen2017 G
NRXN1     2-1514-003chr2:
50174759-50174759
CTintronicDe novo--Yuen2017 G
NRXN1     1-0445-003chr2:
52314858-52314858
ACintergenicDe novo--Yuen2017 G
NRXN1     7-0168-003chr2:
51212586-51212586
GCintronicDe novo--Yuen2017 G
NRXN1     AU1988302chr2:
51128158-51128158
GAintronicDe novo--Yuen2017 G
NRXN1     AU113Achr2:
50464119-50464119
AGintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
NRXN1     2-1283-003chr2:
52385545-52385545
TAintergenicDe novo--Yuen2017 G
NRXN1     M02013chr2:
50733692-50733692
CTexonicMaternalnonsynonymous SNVNM_004801
NM_001135659
c.G2438A
c.G2558A
p.R813H
p.R853H
30.04.247E-5Guo2018 T
NRXN1     2-1365-003chr2:
51590470-51590470
TGintergenicDe novo--Yuen2017 G
NRXN1     5-0014-004chr2:
51902017-51902017
GTintergenicDe novo--Yuen2017 G
NRXN1     AU3885304chr2:
51652073-51652073
CTintergenicDe novo--Yuen2017 G
NRXN1     5-0033-004chr2:
51951889-51951889
CGintergenicDe novo--Yuen2017 G
NRXN1     2-0238-003chr2:
51015982-51015982
ACintronicDe novo--Yuen2017 G
NRXN1     7-0249-003chr2:
52730495-52730495
GAintergenicDe novo--Yuen2017 G
NRXN1     AU3905301chr2:
52187103-52187103
CTintergenicDe novo--Yuen2017 G
NRXN1     Li2017:18488chr2:
50765424-50765424
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G2110A
c.G2230A
p.G704R
p.G744R
29.31.0E-4Li2017 T
NRXN1     1-0336-004chr2:
51165561-51165561
CTintronicDe novo--Yuen2017 G
NRXN1     AU4215302chr2:
52364131-52364131
AGintergenicDe novo--Yuen2017 G
NRXN1     M27891chr2:
50699492-50699492
GAexonicMaternalnonsynonymous SNVNM_004801
NM_001135659
c.C3188T
c.C3308T
p.P1063L
p.P1103L
33.08.42E-6Guo2018 T
Wang2016 T
Wang2020 T
Wang2020 T
NRXN1     AU071804chr2:
52578751-52578751
CGintergenicDe novo--Yuen2017 G
NRXN1     JASD_Fam0198chr2:
51255348-51255348
CGexonicDe novononsynonymous SNVNM_001135659
NM_004801
c.G64C
c.G64C
p.G22R
p.G22R
17.59-Takata2018 E
NRXN1     AU4129303chr2:
52852338-52852338
TCintergenicDe novo--Yuen2017 G
NRXN1     AU4273304chr2:
51390000-51390000
CAintergenicDe novo--Yuen2017 G
NRXN1     2-0182-003chr2:
52874174-52874174
ATintergenicDe novo--Yuen2017 G
NRXN1     2-1295-003chr2:
52235761-52235761
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     AU078503chr2:
50921746-50921746
GCintronicDe novo--Yuen2017 G
NRXN1     AU4344301chr2:
50168075-50168075
GCintronicDe novo--Yuen2017 G
NRXN1     2-0182-003chr2:
52870578-52870578
CTintergenicDe novo--Yuen2017 G
NRXN1     AU078503chr2:
51647896-51647896
ACintergenicDe novo--Yuen2017 G
NRXN1     AU4344301chr2:
50169159-50169159
TCintronicDe novo--Yuen2017 G
NRXN1     2-0182-003chr2:
52110385-52110385
TGintergenicDe novo--Yuen2017 G
NRXN1     AU4444304chr2:
52699520-52699521
TCTintergenicDe novo--Yuen2017 G
NRXN1     1-0497-003chr2:
50778924-50778939
TTCTCTCTCTCTCTCTTTCTCTCTCTCTCTintronicDe novo--Yuen2017 G
NRXN1     2-0318-004chr2:
51475953-51475953
AGintergenicDe novo--Yuen2017 G
NRXN1     AU2123302chr2:
51560458-51560460
TAATAintergenicDe novo--Yuen2017 G
NRXN1     AU030104chr2:
51972268-51972268
AGintergenicDe novo--Yuen2017 G
NRXN1     1-0514-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
NRXN1     AU3913303chr2:
51903015-51903015
GCintergenicDe novo--Yuen2017 G
NRXN1     AU056604chr2:
52631437-52631437
AGintergenicDe novo--Yuen2017 G
NRXN1     2-0318-004chr2:
52739625-52739625
TCintergenicDe novo--Yuen2017 G
NRXN1     2-1292-004chr2:
50406053-50406053
GAintronicDe novo--Yuen2017 G
NRXN1     1-0570-003chr2:
50273297-50273297
TAintronicDe novo--Yuen2017 G
NRXN1     2-0297-003chr2:
52502845-52502845
GAintergenicDe novo--Yuen2017 G
NRXN1     5-0061-003chr2:
51536665-51536665
TCintergenicDe novo--Yuen2017 G
NRXN1     A7chr2:
52886316-52886316
GAintergenicDe novo--Wu2018 G
NRXN1     AU4153301chr2:
52282210-52282210
TCintergenicDe novo--Yuen2017 G
NRXN1     SF0140821.p1chr2:
50779753-50779753
ACexonicDe novononsynonymous SNVNM_004801
NM_001135659
c.T1731G
c.T1851G
p.H577Q
p.H617Q
17.47-Wang2020 T
NRXN1     2-1085-004chr2:
52923863-52923863
GAintergenicDe novo--Yuen2017 G
NRXN1     5-0088-003chr2:
52888177-52888177
CTintergenicDe novo--Yuen2017 G
NRXN1     1-0570-003chr2:
50331938-50331938
TAintronicDe novo--Yuen2017 G
NRXN1     AU4237301chr2:
51092975-51092975
TGintronicDe novo--Yuen2017 G
NRXN1     2-1283-004chr2:
52385545-52385545
TAintergenicDe novo--Yuen2017 G
NRXN1     2-1283-004chr2:
51838526-51838526
TAintergenicDe novo--Yuen2017 G
NRXN1     SF0069869.p1chr2:
50780046-50780046
CGexonicDe novononsynonymous SNVNM_004801
NM_001135659
c.G1438C
c.G1558C
p.D480H
p.D520H
24.7-Wang2020 T
NRXN1     1-0180-004chr2:
50948928-50948928
ACintronicDe novo--Yuen2017 G
NRXN1     2-0307-004chr2:
52142605-52142605
TTTCAAintergenicDe novo--Yuen2017 G
NRXN1     12529.p1chr2:
52393603-52393603
GCintergenicDe novo--Turner2016 G
NRXN1     14642.p1chr2:
52759974-52759974
CTintergenicDe novo--Turner2016 G
NRXN1     AU024004chr2:
52836178-52836178
GAintergenicDe novo--Yuen2017 G
NRXN1     13069.p1chr2:
50912750-50912750
TCintronicDe novo--Turner2016 G
NRXN1     1-0627-003chr2:
51350758-51350758
GTintergenicDe novo--Yuen2017 G
NRXN1     13942.p1chr2:
51531259-51531259
GCintergenicDe novo--Turner2016 G
NRXN1     12011.p1chr2:
52837797-52837797
CTintergenicDe novo--Turner2016 G
NRXN1     13543.p1chr2:
52898231-52898231
AGintergenicDe novo--Turner2016 G
NRXN1     1-0885-003chr2:
51066693-51066693
GTintronicDe novo--Yuen2017 G
NRXN1     AU2140305chr2:
50570296-50570296
TCintronicDe novo--Yuen2017 G
NRXN1     AU2495301chr2:
50379924-50379924
AGintronicDe novo--Yuen2017 G
NRXN1     AU3779304chr2:
50827375-50827375
TCintronicDe novo--Yuen2017 G
NRXN1     1-0482-003chr2:
51609077-51609077
CAintergenicDe novo--Yuen2017 G
NRXN1     1-0065-004chr2:
51076961-51076961
CTintronicDe novo--Yuen2017 G
NRXN1     AU3885305chr2:
51335091-51335091
ACintergenicDe novo--Yuen2017 G
NRXN1     AU4423303chr2:
51381346-51381346
GCintergenicDe novo--Yuen2017 G
NRXN1     AU4423303chr2:
52019172-52019172
CTintergenicDe novo--Yuen2017 G
NRXN1     7-0080-003chr2:
51163130-51163130
TCintronicDe novo--Yuen2017 G
NRXN1     2-0202-004chr2:
50854980-50854980
ATintronicDe novo--Yuen2017 G
NRXN1     2-1093-009chr2:
51678233-51678233
AGintergenicDe novo--Yuen2017 G
NRXN1     SX0014.p1chr2:
50758478-50758478
CTexonicMaternalnonsynonymous SNVNM_004801
NM_001135659
c.G2234A
c.G2354A
p.R745Q
p.R785Q
36.0-Guo2018 T
Wang2020 T
Wang2020 T
NRXN1     2-1116-003chr2:
52592524-52592524
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
NRXN1     1-0487-003chr2:
50548067-50548067
GAintronicDe novo