or
or
Exact

Results for "SCN2A"

Variant Events: 199

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SCN2A     M01813chr2:
166179814-166179816
GAAGexonicDe novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.1821_1822del
c.1821_1822del
c.1821_1822del
p.R607fs
p.R607fs
p.R607fs
--Guo2018 T
Li2017 T
Stessman2017 T
Wang2016 T
Wang2020 T
Wang2020 T
SCN2A     Uddin2014:49chr2:
166201379-166201379
CAexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C2877A
c.C2877A
c.C2877A
p.C959X
p.C959X
p.C959X
42.0-Uddin2014 E
SCN2A     SP0033656chr2:
166170524-166170524
ACexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.A1289C
c.A1289C
c.A1289C
p.E430A
p.E430A
p.E430A
27.9-Feliciano2019 E
SCN2A     Uddin2014:50chr2:
166210819-166210819
GTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.G3037T
c.G3037T
c.G3037T
p.G1013X
p.G1013X
p.G1013X
40.0-Uddin2014 E
SCN2A     M11451chr2:
166201068-166201068
CTexonicUnknown, De novostopgainNM_001040143
NM_001040142
NM_021007
c.C2566T
c.C2566T
c.C2566T
p.R856X
p.R856X
p.R856X
41.0-Guo2018 T
Li2017 T
Stessman2017 T
Wang2016 T
Wang2020 T
Wang2020 T
Wang2020 T
SCN2A     M08856chr2:
166229733-166229733
ACsplicingDe novosplicing25.5-Guo2018 T
Li2017 T
Stessman2017 T
Wang2016 T
Wang2020 T
Wang2020 T
SCN2A     M15222chr2:
166229841-166229841
GCexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G3956C
c.G3956C
c.G3956C
p.R1319P
p.R1319P
p.R1319P
32.0-Guo2018 T
Li2017 T
Stessman2017 T
Stessman2017 T
Wang2016 T
Wang2020 T
Wang2020 T
SCN2A     M12434 Complex Event; expand row to view variants  De novoframeshift insertionNM_001040143
NM_001040142
NM_021007
NM_001040143
NM_001040142
NM_021007
c.229dupC
c.229dupC
c.229dupC
c.230dupC
c.230dupC
c.230dupC
p.V76fs
p.V76fs
p.V76fs
p.P77fs
p.P77fs
p.P77fs
--Guo2018 T
Li2017 T
Stessman2017 T
Stessman2017 T
Wang2016 T
Wang2020 T
Wang2020 T
SCN2A     M21522 Complex Event; expand row to view variants  De novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.5711_5712del
c.5711_5712del
c.5711_5712del
p.Q1904fs
p.Q1904fs
p.Q1904fs
--Guo2018 T
Li2017 T
Stessman2017 T
Stessman2017 T
Wang2016 T
Wang2020 T
Wang2020 T
SCN2A     M21701chr2:
166167003-166167003
AGexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.A868G
c.A868G
c.A868G
p.I290V
p.I290V
p.I290V
5.129-Guo2018 T
Li2017 T
Wang2016 T
SCN2A     AU3861302chr2:
166273480-166273480
GAintergenicDe novo--Yuen2017 G
SCN2A     M23243 Complex Event; expand row to view variants  De novoframeshift deletionNM_001040143
NM_001040142
NM_021007
NM_001040143
NM_001040142
NM_021007
c.4794_4795del
c.4794_4795del
c.4794_4795del
c.4795_4796del
c.4795_4796del
c.4795_4796del
p.D1598fs
p.D1598fs
p.D1598fs
p.F1599fs
p.F1599fs
p.F1599fs
--Guo2018 T
Li2017 T
Stessman2017 T
Stessman2017 T
Wang2016 T
Wang2020 T
Wang2020 T
SCN2A     M23149chr2:
166245634-166245634
CTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C5318T
c.C5318T
c.C5318T
p.A1773V
p.A1773V
p.A1773V
18.44-Guo2018 T
Li2017 T
Wang2016 T
SCN2A     M3353chr2:
166172026-166172026
GTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G1429T
c.G1429T
c.G1429T
p.A477S
p.A477S
p.A477S
10.13-Li2017 T
Wang2016 T
SCN2A     18.s1chr2:
166231244-166231244
TGexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.T4022G
c.T4022G
c.T4022G
p.L1341R
p.L1341R
p.L1341R
21.8-An2014 E
Ben-Shalom2017 T
SCN2A     M17520chr2:
166210825-166210825
GAexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G3043A
c.G3043A
c.G3043A
p.D1015N
p.D1015N
p.D1015N
9.165-Guo2018 T
Wang2016 T
SCN2A     2-1239-003chr2:
166198249-166198249
CTintronicDe novo--Yuen2016 G
Yuen2017 G
SCN2A     Husson2020:78chr2:
166179793-166179794
CCCexonicframeshift deletionNM_001040143
NM_001040142
NM_021007
c.1800delC
c.1800delC
c.1800delC
p.T600fs
p.T600fs
p.T600fs
--Husson2020 E
SCN2A     M21738chr2:
166221707-166221707
GAexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G3454A
c.G3454A
c.G3454A
p.A1152T
p.A1152T
p.A1152T
11.95.767E-5Wang2016 T
SCN2A     AU024703chr2:
166246020-166246020
CTexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C5704T
c.C5704T
c.C5704T
p.R1902C
p.R1902C
p.R1902C
15.374.128E-5Stessman2017 T
Wang2020 T
Wang2020 T
SCN2A     14525.p1chr2:
166152367-166152367
GAexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G34A
c.G34A
c.G34A
p.D12N
p.D12N
p.D12N
13.34-Ben-Shalom2017 T
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
SCN2A     ASDFI_732chr2:
166152578-166152578
AGexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.A245G
c.A245G
c.A245G
p.D82G
p.D82G
p.D82G
19.73-Ben-Shalom2017 T
DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Wang2020 T
SCN2A     220-9813-201chr2:
166170231-166170231
GAexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G1136A
c.G1136A
c.G1136A
p.R379H
p.R379H
p.R379H
35.0-Wang2020 T
SCN2A     AU026Achr2:
166170231-166170231
GAexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G1136A
c.G1136A
c.G1136A
p.R379H
p.R379H
p.R379H
35.0-Ben-Shalom2017 T
DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
SCN2A     DEASD_0143_001chr2:
166170231-166170231
GAexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G1136A
c.G1136A
c.G1136A
p.R379H
p.R379H
p.R379H
35.0-Ben-Shalom2017 T
DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Wang2020 T
SCN2A     10C109819chr2:
166183403-166183403
TTAexonicDe novoframeshift insertionNM_001040143
NM_001040142
NM_021007
c.2058_2059insA
c.2058_2059insA
c.2058_2059insA
p.S686fs
p.S686fs
p.S686fs
--Ben-Shalom2017 T
DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
SCN2A     13951.p1chr2:
166147847-166147847
ACintronicDe novo--Turner2016 G
SCN2A     Li2017:23243chr2:
166243497-166243499
ATTAexonicUnknownframeshift deletionNM_001040143
NM_001040142
NM_021007
c.4794_4795del
c.4794_4795del
c.4794_4795del
p.D1598fs
p.D1598fs
p.D1598fs
--Li2017 T
SCN2A     14280.p1chr2:
166201311-166201311
CTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C2809T
c.C2809T
c.C2809T
p.R937C
p.R937C
p.R937C
29.0-Ben-Shalom2017 T
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
SCN2A     NDAR_INVTZ957VTW_wes1chr2:
166201312-166201312
GAexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G2810A
c.G2810A
c.G2810A
p.R937H
p.R937H
p.R937H
33.0-Ben-Shalom2017 T
DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
SCN2A     11892.p1chr2:
166201379-166201379
CAexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C2877A
c.C2877A
c.C2877A
p.C959X
p.C959X
p.C959X
42.0-Ben-Shalom2017 T
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Sanders2012 E
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
Willsey2013 E
SCN2A     11114.p1chr2:
166210819-166210819
GTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.G3037T
c.G3037T
c.G3037T
p.G1013X
p.G1013X
p.G1013X
40.0-Ben-Shalom2017 T
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Sanders2012 E
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
Willsey2013 E
SCN2A     Yin2020:137chr2:
166245865-166245865
AGexonicnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.A5549G
c.A5549G
c.A5549G
p.D1850G
p.D1850G
p.D1850G
16.97-Yin2020 T
SCN2A     AU0918301 Complex Event; expand row to view variants  De novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.3929delC
c.3929delC
c.3929delC
p.A1310fs
p.A1310fs
p.A1310fs
--Stessman2017 T
Stessman2017 T
Wang2020 T
Wang2020 T
SCN2A     13544.p1chr2:
166231378-166231378
TCexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.T4156C
c.T4156C
c.T4156C
p.C1386R
p.C1386R
p.C1386R
15.44-Ben-Shalom2017 T
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
SCN2A     AU031404chr2:
166110073-166110073
TAintronicDe novo--Yuen2017 G
SCN2A     110.04chr2:
166201197-166201197
GAexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G2695A
c.G2695A
c.G2695A
p.G899S
p.G899S
p.G899S
35.0-Wang2020 T
Wang2020 T
SCN2A     13642.p1chr2:
166234111-166234111
CTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C4259T
c.C4259T
c.C4259T
p.T1420M
p.T1420M
p.T1420M
28.0-Ben-Shalom2017 T
Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
SCN2A     AU031404chr2:
166115121-166115121
CTintronicDe novo--Yuen2017 G
SCN2A     210-18213-303chr2:
166198962-166198962
CAexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C2545A
c.C2545A
c.C2545A
p.L849I
p.L849I
p.L849I
23.3-Wang2020 T
Wang2020 T
Wang2020 T
SCN2A     AN09714chr2:
166237699-166237699
CTexonicUnknown, De novostopgainNM_001040143
NM_001040142
NM_021007
c.C4543T
c.C4543T
c.C4543T
p.R1515X
p.R1515X
p.R1515X
43.0-Ben-Shalom2017 T
D’Gama2015 T
SCN2A     AN08043chr2:
166237708-166237708
GCsplicingUnknown, De novosplicing22.2-Ben-Shalom2017 T
D’Gama2015 T
SCN2A     DEASD_0262_001chr2:
166245137-166245137
ATsplicingDe novosplicing12.35-Ben-Shalom2017 T
DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Wang2020 T
SCN2A     303758chr2:
166201362-166201362
GAexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G2860A
c.G2860A
c.G2860A
p.A954T
p.A954T
p.A954T
28.88.236E-6Wang2020 T
Wang2020 T
Wang2020 T
Wang2020 T
SCN2A     29788chr2:
166183395-166183395
CTexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C2050T
c.C2050T
c.C2050T
p.R684W
p.R684W
p.R684W
17.892.0E-4Wang2020 T
SCN2A     AN04166chr2:
166245546-166245546
GAexonicUnknown, De novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G5230A
c.G5230A
c.G5230A
p.G1744R
p.G1744R
p.G1744R
18.99-Ben-Shalom2017 T
D’Gama2015 T
SCN2A     155630chr2:
166201362-166201362
GAexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G2860A
c.G2860A
c.G2860A
p.A954T
p.A954T
p.A954T
28.88.236E-6Wang2020 T
Wang2020 T
Wang2020 T
Wang2020 T
SCN2A     214-17091-1chr2:
166183395-166183395
CTexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C2050T
c.C2050T
c.C2050T
p.R684W
p.R684W
p.R684W
17.892.0E-4Wang2020 T
Wang2020 T
SCN2A     SX0088.p1chr2:
166226727-166226727
ATexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.A3767T
c.A3767T
c.A3767T
p.E1256V
p.E1256V
p.E1256V
27.9-Wang2020 T
Wang2020 T
SCN2A     M8805chr2:
166201311-166201311
CTexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C2809T
c.C2809T
c.C2809T
p.R937C
p.R937C
p.R937C
29.0-Wang2020 T
Wang2020 T
SCN2A     ASDchr2:
166246237-166246237
CTexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C5921T
c.C5921T
c.C5921T
p.S1974L
p.S1974L
p.S1974L
19.3-Wang2020 T
SCN2A     SD0352.p1chr2:
166229768-166229768
GTexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G3883T
c.G3883T
c.G3883T
p.G1295C
p.G1295C
p.G1295C
32.0-Wang2020 T
Wang2020 T
SCN2A     SD0305.p1chr2:
166226663-166226663
CTexonicUnknownstopgainNM_001040143
NM_001040142
NM_021007
c.C3703T
c.C3703T
c.C3703T
p.R1235X
p.R1235X
p.R1235X
43.0-Wang2020 T
Wang2020 T
SCN2A     557.03chr2:
166201379-166201379
CAexonicUnknownstopgainNM_001040143
NM_001040142
NM_021007
c.C2877A
c.C2877A
c.C2877A
p.C959X
p.C959X
p.C959X
42.0-Wang2020 T
Wang2020 T
Wang2020 T
SCN2A     GD0098.p1chr2:
166198981-166198981
TCsplicingUnknownsplicing24.6-Wang2020 T
Wang2020 T
SCN2A     HEN468.p1chr2:
166179921-166179921
ATexonicUnknownstopgainNM_001040143
NM_001040142
NM_021007
c.A1927T
c.A1927T
c.A1927T
p.K643X
p.K643X
p.K643X
41.0-Wang2020 T
Wang2020 T
SCN2A     187.04chr2:
166201379-166201379
CAexonicUnknownstopgainNM_001040143
NM_001040142
NM_021007
c.C2877A
c.C2877A
c.C2877A
p.C959X
p.C959X
p.C959X
42.0-Wang2020 T
Wang2020 T
SCN2A     80954241chr2:
166201362-166201362
GAexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G2860A
c.G2860A
c.G2860A
p.A954T
p.A954T
p.A954T
28.88.236E-6Wang2020 T
Wang2020 T
SCN2A     ASD1465chr2:
166246237-166246237
CTexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C5921T
c.C5921T
c.C5921T
p.S1974L
p.S1974L
p.S1974L
19.3-Wang2020 T
SCN2A     M03713chr2:
166223772-166223772
GAexonicMaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G3566A
c.G3566A
c.G3566A
p.G1189D
p.G1189D
p.G1189D
19.476.592E-5Guo2018 T
SCN2A     M08590chr2:
166170611-166170611
ACexonicMaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.A1376C
c.A1376C
c.A1376C
p.E459A
p.E459A
p.E459A
12.716.125E-5Guo2018 T
SCN2A     1-0184-003chr2:
166289459-166289459
TCintergenicDe novo--Yuen2017 G
SCN2A     M27791chr2:
166245867-166245867
CTexonicMaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C5551T
c.C5551T
c.C5551T
p.R1851W
p.R1851W
p.R1851W
14.21-Guo2018 T
SCN2A     M03303chr2:
166187887-166187887
GCexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G2197C
c.G2197C
c.G2197C
p.A733P
p.A733P
p.A733P
34.0-Guo2018 T
Wang2016 T
SCN2A     M03683chr2:
166165304-166165304
CC/TexonicMaternal--Guo2018 T
SCN2A     M20553chr2:
166165277-166165277
GC/GexonicMaternal--Guo2018 T
SCN2A     2-1251-003chr2:
166246205-166246205
CTexonicDe novosynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C5889T
c.C5889T
c.C5889T
p.T1963T
p.T1963T
p.T1963T
-1.654E-5Yuen2017 G
SCN2A     AU024105chr2:
166183579-166183579
TGintronicDe novo--Yuen2017 G
SCN2A     Li2017:27906chr2:
166245838-166245838
CTexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C5522T
c.C5522T
c.C5522T
p.A1841V
p.A1841V
p.A1841V
14.76-Li2017 T
SCN2A     SSC03177chr2:
166201379-166201379
CAexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C2877A
c.C2877A
c.C2877A
p.C959X
p.C959X
p.C959X
42.0-Lim2017 E
SCN2A     SSC11033chr2:
166201311-166201311
CTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C2809T
c.C2809T
c.C2809T
p.R937C
p.R937C
p.R937C
29.0-Lim2017 E
SCN2A     SSC08396chr2:
166231378-166231378
TCexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.T4156C
c.T4156C
c.T4156C
p.C1386R
p.C1386R
p.C1386R
15.44-Lim2017 E
SCN2A     SSC00344chr2:
166210819-166210819
GTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.G3037T
c.G3037T
c.G3037T
p.G1013X
p.G1013X
p.G1013X
40.0-Lim2017 E
SCN2A     Lim2017:36783chr2:
166152367-166152367
GAexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G34A
c.G34A
c.G34A
p.D12N
p.D12N
p.D12N
13.34-Lim2017 E
SCN2A     BK786.01chr2:
166164394-166164396
CAACAexonicUnknownframeshift deletionNM_001040143
NM_001040142
NM_021007
c.425delA
c.425delA
c.425delA
p.N142fs
p.N142fs
p.N142fs
--Wang2020 T
Wang2020 T
SCN2A     GX0080.p1chr2:
166179898-166179898
TC/TexonicPaternal--Guo2018 T
SCN2A     GX0356.p1chr2:
166152542-166152542
CTexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C209T
c.C209T
c.C209T
p.P70L
p.P70L
p.P70L
22.6-Guo2018 T
SCN2A     GX0152.p1chr2:
166223867-166223867
AGexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.A3661G
c.A3661G
c.A3661G
p.S1221G
p.S1221G
p.S1221G
26.5-Guo2018 T
SCN2A     HN0049.p1chr2:
166210825-166210825
GAexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G3043A
c.G3043A
c.G3043A
p.D1015N
p.D1015N
p.D1015N
9.165-Guo2018 T
SCN2A     SP0037822chr2:
166187917-166187917
ATexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.A2227T
c.A2227T
c.A2227T
p.K743X
p.K743X
p.K743X
40.0-Feliciano2019 E
SCN2A     GX0019.p1chr2:
166246069-166246069
GAexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G5753A
c.G5753A
c.G5753A
p.R1918H
p.R1918H
p.R1918H
16.794.957E-5Guo2018 T
SCN2A     AU4013303chr2:
166156738-166156738
AGintronicDe novo--Yuen2017 G
SCN2A     Mahjani2021:88chr2:
166243526-166243526
GAexonicnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G4822A
c.G4822A
c.G4822A
p.G1608R
p.G1608R
p.G1608R
28.5-Mahjani2021 E
SCN2A     Cherot2017:4chr2:
166231381-166231383
AAAAexonicUnknownframeshift deletionNM_001040143
NM_001040142
NM_021007
c.4160_4161del
c.4160_4161del
c.4160_4161del
p.K1387fs
p.K1387fs
p.K1387fs
--Cherot2017 E
SCN2A     00160-D8G5Fchr2:
166166958-166166958
CTexonicUnknownstopgainNM_001040143
NM_001040142
NM_021007
c.C823T
c.C823T
c.C823T
p.R275X
p.R275X
p.R275X
24.7-Wang2020 T
Wang2020 T
SCN2A     5006_202chr2:
166164448-166164448
GAsplicingDe novosplicing25.6-Lim2017 E
Willsey2013 E
SCN2A     AU_349chr2:
166201311-166201311
CTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C2809T
c.C2809T
c.C2809T
p.R937C
p.R937C
p.R937C
29.0-Satterstrom2020 E
SCN2A     3-0261-000chr2:
166237202-166237202
GCexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G4409C
c.G4409C
c.G4409C
p.G1470A
p.G1470A
p.G1470A
26.1-Tammimies2015 E
Tammimies2015 E
SCN2A     M17441chr2:
166179813-166179813
CTexonicUnknown, De novostopgainNM_001040143
NM_001040142
NM_021007
c.C1819T
c.C1819T
c.C1819T
p.R607X
p.R607X
p.R607X
39.08.245E-6Guo2018 T
Stessman2017 T
Stessman2017 T
Wang2016 T
Wang2020 T
Wang2020 T
SCN2A     1-0551-004chr2:
166196717-166196717
CGintronicDe novo--Yuen2017 G
SCN2A     M08704chr2:
166153563-166153563
CTexonicUnknownstopgainNM_001040143
NM_001040142
NM_021007
c.C304T
c.C304T
c.C304T
p.R102X
p.R102X
p.R102X
39.0-Guo2018 T
Wang2020 T
Wang2020 T
SCN2A     AU2293302chr2:
166203834-166203834
CTintronicDe novo--Yuen2017 G
SCN2A     M19672chr2:
166170189-166170189
CTexonicUnknown, De novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C1094T
c.C1094T
c.C1094T
p.T365M
p.T365M
p.T365M
26.7-Guo2018 T
Stessman2017 T
Wang2016 T
Wang2020 T
Wang2020 T
SCN2A     3C024chr2:
166231426-166231426
ATexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.A4204T
c.A4204T
c.A4204T
p.K1402X
p.K1402X
p.K1402X
43.0-Satterstrom2020 E
SCN2A     Stessman2017:ASD_1465chr2:
166246237-166246237
CTexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C5921T
c.C5921T
c.C5921T
p.S1974L
p.S1974L
p.S1974L
19.3-Stessman2017 T
SCN2A     2-1337-003chr2:
166177125-166177125
TAintronicDe novo--Yuen2016 G
Yuen2017 G
SCN2A     HN0130.p1chr2:
166170536-166170538
CCACexonicDe novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.1302_1303del
c.1302_1303del
c.1302_1303del
p.A434fs
p.A434fs
p.A434fs
--Guo2018 T
Wang2020 T
Wang2020 T
SCN2A     GX0205.p1chr2:
166170175-166170176
CACexonicDe novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.1081delA
c.1081delA
c.1081delA
p.N361fs
p.N361fs
p.N361fs
--Guo2018 T
Wang2020 T
Wang2020 T
SCN2A     GX0234.p1chr2:
166234155-166234155
CTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C4303T
c.C4303T
c.C4303T
p.R1435X
p.R1435X
p.R1435X
40.0-Guo2018 T
Wang2020 T
Wang2020 T
SCN2A     4050_16mrchr2:
166226780-166226780
TGexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.T3820G
c.T3820G
c.T3820G
p.W1274G
p.W1274G
p.W1274G
23.5-Satterstrom2020 E
SCN2A     2-1291-003chr2:
166152415-166152415
CTexonicInheritednonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C82T
c.C82T
c.C82T
p.R28C
p.R28C
p.R28C
23.72.0E-4Ben-Shalom2017 T
Jiang2013 G
SCN2A     2-1337-003 Complex Event; expand row to view variants  De novoframeshift deletionNM_001040143
NM_001040142
NM_021007
NM_001040143
NM_001040142
NM_021007
NM_001040143
NM_001040142
NM_021007
c.1318_1348del
c.1318_1348del
c.1318_1348del
c.1318_1349del
c.1318_1349del
c.1318_1349del
c.1315_1346del
c.1315_1346del
c.1315_1346del
p.E440fs
p.E440fs
p.E440fs
p.E440fs
p.E440fs
p.E440fs
p.A439fs
p.A439fs
p.A439fs
--Ben-Shalom2017 T
Jiang2013 G
Wang2020 T
Yuen2016 G
SCN2A     SD0071.p1chr2:
166179706-166179706
GAexonicMaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G1712A
c.G1712A
c.G1712A
p.R571H
p.R571H
p.R571H
27.87.488E-5Guo2018 T
SCN2A     tavassoli2014_sample1chr2:
166164448-166164448
GAsplicingDe novosplicing25.6-Wang2020 T
SCN2A     SD0014.p1chr2:
166172033-166172033
GTexonicMaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G1436T
c.G1436T
c.G1436T
p.G479V
p.G479V
p.G479V
17.543.303E-5Guo2018 T
SCN2A     1-0578-003chr2:
166179813-166179813
CTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C1819T
c.C1819T
c.C1819T
p.R607X
p.R607X
p.R607X
39.08.245E-6Wang2020 T
SCN2A     P101chr2:
166229846-166229846
GAexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G3961A
c.G3961A
c.G3961A
p.E1321K
p.E1321K
p.E1321K
36.0-Long2019 ET
SCN2A     P045chr2:
166198975-166198975
GAexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G2558A
c.G2558A
c.G2558A
p.R853Q
p.R853Q
p.R853Q
35.0-Long2019 ET
SCN2A     SX0013.p1chr2:
166170605-166170605
AGexonicMaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.A1370G
c.A1370G
c.A1370G
p.Q457R
p.Q457R
p.Q457R
25.5-Guo2018 T
SCN2A     1-0264-005chr2:
166245546-166245546
GTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.G5230T
c.G5230T
c.G5230T
p.G1744X
p.G1744X
p.G1744X
44.0-Wang2020 T
SCN2A     Li2017:17441chr2:
166179813-166179813
CTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C1819T
c.C1819T
c.C1819T
p.R607X
p.R607X
p.R607X
39.08.245E-6Li2017 T
SCN2A     M01793chr2:
166172026-166172026
GTexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G1429T
c.G1429T
c.G1429T
p.A477S
p.A477S
p.A477S
10.13-Guo2018 T
SCN2A     M18352chr2:
166152416-166152416
GAexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G83A
c.G83A
c.G83A
p.R28H
p.R28H
p.R28H
27.3-Guo2018 T
SCN2A     Codina-Sola2015:ASD_5chr2:
166179741-166179741
CTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C1747T
c.C1747T
c.C1747T
p.R583X
p.R583X
p.R583X
39.0-Ben-Shalom2017 T
Codina-Sola2015 E
SCN2A     09C83888chr2:
166172241-166172241
TAexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.T1644A
c.T1644A
c.T1644A
p.Y548X
p.Y548X
p.Y548X
38.0-Satterstrom2020 E
SCN2A     IGM4516chr2:
166229799-166229799
TGexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.T3914G
c.T3914G
c.T3914G
p.L1305R
p.L1305R
p.L1305R
29.3-Satterstrom2020 E
SCN2A     HEN0329.p1chr2:
166201068-166201068
CTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C2566T
c.C2566T
c.C2566T
p.R856X
p.R856X
p.R856X
41.0-Guo2018 T
Wang2020 T
Wang2020 T
SCN2A     M03353chr2:
166172026-166172026
GTexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G1429T
c.G1429T
c.G1429T
p.A477S
p.A477S
p.A477S
10.13-Guo2018 T
SCN2A     D’Gama2015:4849chr2:
166183366-166183366
CAexonicUnknown, De novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C2021A
c.C2021A
c.C2021A
p.T674K
p.T674K
p.T674K
16.28-Ben-Shalom2017 T
D’Gama2015 T
SCN2A     Codina-Sola2015:ASD_15chr2:
166231336-166231336
GAexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G4114A
c.G4114A
c.G4114A
p.G1372R
p.G1372R
p.G1372R
22.7-Codina-Sola2015 E
SCN2A     M10099chr2:
166170189-166170189
CTexonicUnknown, Maternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C1094T
c.C1094T
c.C1094T
p.T365M
p.T365M
p.T365M
26.7-Guo2018 T
Wang2016 T
Wang2020 T
Wang2020 T
Wang2020 T
SCN2A     GX0569.p1chr2:
166165305-166165305
GAsplicingUnknown, De novosplicing17.27-Guo2018 T
Wang2020 T
Wang2020 T
SCN2A     M27792chr2:
166245867-166245867
CTexonicMaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C5551T
c.C5551T
c.C5551T
p.R1851W
p.R1851W
p.R1851W
14.21-Guo2018 T
Wang2016 T
SCN2A     M20316chr2:
166246144-166246144
CTexonicMaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C5828T
c.C5828T
c.C5828T
p.T1943I
p.T1943I
p.T1943I
8.359-Guo2018 T
Wang2016 T
SCN2A     M10009chr2:
166223735-166223735
CTexonicMaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C3529T
c.C3529T
c.C3529T
p.R1177W
p.R1177W
p.R1177W
20.11.649E-5Guo2018 T
Wang2016 T
Wang2020 T
Wang2020 T
SCN2A     M27906chr2:
166245838-166245838
CTexonicMaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C5522T
c.C5522T
c.C5522T
p.A1841V
p.A1841V
p.A1841V
14.76-Guo2018 T
Wang2016 T
SCN2A     M8590chr2:
166170611-166170611
ACexonicMaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.A1376C
c.A1376C
c.A1376C
p.E459A
p.E459A
p.E459A
12.716.125E-5Wang2016 T
SCN2A     210-18213-302chr2:
166198962-166198962
CAexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C2545A
c.C2545A
c.C2545A
p.L849I
p.L849I
p.L849I
23.3-Stessman2017 T
Wang2020 T
Wang2020 T
SCN2A     SX0026.p1chr2:
166165305-166165305
GAsplicingUnknownsplicing17.27-Guo2018 T
Wang2020 T
Wang2020 T
SCN2A     Li2017:18352chr2:
166152416-166152416
GAexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G83A
c.G83A
c.G83A
p.R28H
p.R28H
p.R28H
27.3-Li2017 T
SCN2A     M20573 Complex Event; expand row to view variants  Unknown, Paternalframeshift deletion, frameshift substitutionNM_001040143
NM_001040142
NM_021007
NM_001040143
NM_001040142
NM_021007
NM_001040143
NM_001040142
NM_021007
c.4504delA
c.4504delA
c.4504delA
c.4509_4510T
c.4509_4510T
c.4509_4510T
c.4503delG
c.4503delG
c.4503delG
p.K1502fs
p.K1502fs
p.K1502fs
N/A
N/A
N/A
p.M1501fs
p.M1501fs
p.M1501fs
--Guo2018 T
Stessman2017 T
Wang2016 T
Wang2020 T
Wang2020 T
Wang2020 T
Wang2020 T
SCN2A     HEN0166.p1chr2:
166243281-166243282
ATAexonicUnknownframeshift deletionNM_001040143
NM_001040142
NM_021007
c.4578delT
c.4578delT
c.4578delT
p.D1526fs
p.D1526fs
p.D1526fs
--Guo2018 T
Wang2020 T
Wang2020 T
SCN2A     M27874chr2:
166243261-166243261
ACexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.A4557C
c.A4557C
c.A4557C
p.K1519N
p.K1519N
p.K1519N
13.75-Guo2018 T
Wang2016 T
SCN2A     ER8490chr2:
166179824-166179826
TCTTexonicDe novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.1831_1832del
c.1831_1832del
c.1831_1832del
p.L611fs
p.L611fs
p.L611fs
--Ben-Shalom2017 T
SCN2A     ZH60991chr2:
166201311-166201311
CTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C2809T
c.C2809T
c.C2809T
p.R937C
p.R937C
p.R937C
29.0-Ben-Shalom2017 T
SCN2A     OMIM.0008chr2:
166153563-166153563
CTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C304T
c.C304T
c.C304T
p.R102X
p.R102X
p.R102X
39.0-Ben-Shalom2017 T
SCN2A     M13320chr2:
166221743-166221743
TCexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.T3490C
c.T3490C
c.T3490C
p.S1164P
p.S1164P
p.S1164P
10.61-Guo2018 T
Wang2016 T
SCN2A     M4113chr2:
166245706-166245706
TCexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.T5390C
c.T5390C
c.T5390C
p.M1797T
p.M1797T
p.M1797T
11.962.473E-5Wang2016 T
SCN2A     Ben-Shalom2017:48chr2:
166234155-166234155
CTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C4303T
c.C4303T
c.C4303T
p.R1435X
p.R1435X
p.R1435X
40.0-Ben-Shalom2017 T
SCN2A     M20308chr2:
166179835-166179835
CTexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C1841T
c.C1841T
c.C1841T
p.P614L
p.P614L
p.P614L
25.14.125E-5Guo2018 T
Wang2016 T
Wang2020 T
Wang2020 T
SCN2A     GX0563.p1chr2:
166170611-166170611
ACexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.A1376C
c.A1376C
c.A1376C
p.E459A
p.E459A
p.E459A
12.716.125E-5Guo2018 T
SCN2A     M23727chr2:
166246068-166246068
CTexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C5752T
c.C5752T
c.C5752T
p.R1918C
p.R1918C
p.R1918C
8.4698.261E-5Guo2018 T
Wang2016 T
SCN2A     HEN0138.p1chr2:
166231397-166231397
GAexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G4175A
c.G4175A
c.G4175A
p.S1392N
p.S1392N
p.S1392N
3.648-Guo2018 T
SCN2A     GX0570.p1chr2:
166179963-166179963
GAexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G1969A
c.G1969A
c.G1969A
p.V657I
p.V657I
p.V657I
16.378.782E-6Guo2018 T
SCN2A     M30859chr2:
166201312-166201312
GAexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G2810A
c.G2810A
c.G2810A
p.R937H
p.R937H
p.R937H
33.0-Guo2018 T
Wang2020 T
Wang2020 T
SCN2A     M30337chr2:
166168598-166168598
GAexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G1034A
c.G1034A
c.G1034A
p.G345D
p.G345D
p.G345D
34.0-Guo2018 T
SCN2A     03HI2712Achr2:
166179685-166179685
GTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G1691T
c.G1691T
c.G1691T
p.G564V
p.G564V
p.G564V
23.5-Satterstrom2020 E
SCN2A     G01-GEA-293-HIchr2:
166237636-166237636
CTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C4480T
c.C4480T
c.C4480T
p.Q1494X
p.Q1494X
p.Q1494X
43.0-Satterstrom2020 E
SCN2A     211-5580-3 Complex Event; expand row to view variants  Unknown, Inheritedframeshift deletionNM_001040143
NM_001040142
NM_021007
NM_001040143
NM_001040142
NM_021007
c.1316_1347del
c.1316_1347del
c.1316_1347del
c.1315_1346del
c.1315_1346del
c.1315_1346del
p.A439fs
p.A439fs
p.A439fs
p.A439fs
p.A439fs
p.A439fs
--Stessman2017 T
Wang2020 T
Wang2020 T
SCN2A     G01-GEA-263-HIchr2:
166170276-166170276
GAintronicDe novo--Satterstrom2020 E
SCN2A     21730-34469chr2:
166153564-166153564
GAexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G305A
c.G305A
c.G305A
p.R102Q
p.R102Q
p.R102Q
36.0-Callaghan2019 G
SCN2A     HEN0138.p1chr2:
166245220-166245220
GAexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G4904A
c.G4904A
c.G4904A
p.R1635Q
p.R1635Q
p.R1635Q
18.57-Guo2018 T
SCN2A     GX0363.p1chr2:
166201266-166201266
CTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C2764T
c.C2764T
c.C2764T
p.R922C
p.R922C
p.R922C
24.3-Guo2018 T
Wang2020 T
Wang2020 T
SCN2A     M32128chr2:
166170419-166170419
GCexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G1184C
c.G1184C
c.G1184C
p.R395P
p.R395P
p.R395P
27.3-Guo2018 T
Wang2020 T
Wang2020 T
SCN2A     GX0421.p1chr2:
166245590-166245590
TGexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.T5274G
c.T5274G
c.T5274G
p.S1758R
p.S1758R
p.S1758R
14.6-Guo2018 T
SCN2A     SX0030.p1chr2:
166237617-166237617
CGexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C4461G
c.C4461G
c.C4461G
p.D1487E
p.D1487E
p.D1487E
16.92-Guo2018 T
SCN2A     SX0006.p1chr2:
166245546-166245546
GAexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G5230A
c.G5230A
c.G5230A
p.G1744R
p.G1744R
p.G1744R
18.99-Guo2018 T
SCN2A     HEN0278.p1chr2:
166245632-166245632
CGexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C5316G
c.C5316G
c.C5316G
p.I1772M
p.I1772M
p.I1772M
10.84-Guo2018 T
SCN2A     1-0385-003chr2:
166263353-166263359
GAAAAAAGAAAAAintergenicDe novo--Yuen2017 G
SCN2A     Li2017:19672chr2:
166170189-166170189
CTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C1094T
c.C1094T
c.C1094T
p.T365M
p.T365M
p.T365M
26.7-Li2017 T
SCN2A     215-13221-2433chr2:
166245192-166245192
CTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C4876T
c.C4876T
c.C4876T
p.R1626X
p.R1626X
p.R1626X
42.0-Stessman2017 T
Stessman2017 T
Wang2020 T
Wang2020 T
SCN2A     09C99852chr2:
166170549-166170581
GGCTGAACAGAAGGAAGCTGAATTTCAGCAGATGexonicDe novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.1315_1346del
c.1315_1346del
c.1315_1346del
p.A439fs
p.A439fs
p.A439fs
--Satterstrom2020 E
SCN2A     2-0214-004chr2:
166164058-166164058
GAintronicDe novo--Yuen2017 G
SCN2A     21705-34281chr2:
166168534-166168534
GAsplicingDe novosplicing23.6-Callaghan2019 G
SCN2A     M1793chr2:
166172026-166172026
GTexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G1429T
c.G1429T
c.G1429T
p.A477S
p.A477S
p.A477S
10.13-Wang2016 T
SCN2A     M08494chr2:
166153564-166153564
GAexonicPaternalnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G305A
c.G305A
c.G305A
p.R102Q
p.R102Q
p.R102Q
36.0-Guo2018 T
Wang2016 T
Wang2020 T
Wang2020 T
SCN2A     SF0064892.p1chr2:
166201068-166201068
CTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C2566T
c.C2566T
c.C2566T
p.R856X
p.R856X
p.R856X
41.0-Wang2020 T
SCN2A     SF0057026.p1chr2:
166198965-166198965
CTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C2548T
c.C2548T
c.C2548T
p.R850X
p.R850X
p.R850X
41.0-Wang2020 T
SCN2A     SF0058702.p1chr2:
166211058-166211060
CATCexonicDe novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.3277_3278del
c.3277_3278del
c.3277_3278del
p.M1093fs
p.M1093fs
p.M1093fs
--Wang2020 T
SCN2A     SF0021865.p1chr2:
166201122-166201132
ATTGGCAATTCAexonicDe novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.2621_2630del
c.2621_2630del
c.2621_2630del
p.I874fs
p.I874fs
p.I874fs
--Wang2020 T
SCN2A     SF0107584.p1chr2:
166152587-166152587
AGexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.A254G
c.A254G
c.A254G
p.Y85C
p.Y85C
p.Y85C
17.36-Wang2020 T
SCN2A     SF0026028.p1chr2:
166198965-166198965
CTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C2548T
c.C2548T
c.C2548T
p.R850X
p.R850X
p.R850X
41.0-Wang2020 T
SCN2A     AU048206chr2:
166168667-166168667
ACintronicDe novo--Yuen2017 G
SCN2A     SF0120159.p1chr2:
166170233-166170233
CTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C1138T
c.C1138T
c.C1138T
p.L380F
p.L380F
p.L380F
25.4-Wang2020 T
SCN2A     01C07361chr2:
166229813-166229814
GCGexonicDe novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.3929delC
c.3929delC
c.3929delC
p.A1310fs
p.A1310fs
p.A1310fs
--Satterstrom2020 E
SCN2A     03C21394chr2:
166179685-166179685
GTexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G1691T
c.G1691T
c.G1691T
p.G564V
p.G564V
p.G564V
23.5-Stessman2017 T
Wang2020 T
Wang2020 T
SCN2A     SF0006503.p1chr2:
166245697-166245697
ATexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.A5381T
c.A5381T
c.A5381T
p.D1794V
p.D1794V
p.D1794V
17.42-Wang2020 T
SCN2A     SF0106019.p1chr2:
166245454-166245454
CTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C5138T
c.C5138T
c.C5138T
p.S1713F
p.S1713F
p.S1713F
16.95-Wang2020 T
SCN2A     SF0033956.p1chr2:
166245441-166245441
CTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C5125T
c.C5125T
c.C5125T
p.Q1709X
p.Q1709X
p.Q1709X
43.0-Wang2020 T
SCN2A     SF0016101.p1chr2:
166245634-166245634
CTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C5318T
c.C5318T
c.C5318T