or
or
Exact

Results for "KMT2A"

Variant Events: 58

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KMT2A     SD0115.p1chr11:
118372513-118372513
GAexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.G6446A
c.G6437A
p.R2149Q
p.R2146Q
21.82.472E-5Wang2020 T
Wang2020 T
KMT2A     13515.p1chr11:
118337993-118337993
GAintronicDe novo--Chan2019 GET
Turner2016 G
KMT2A     2-1005-003chr11:
118374301-118374303
CTGCexonicDe novoframeshift deletionNM_001197104
NM_005933
c.7695_7696del
c.7686_7687del
p.S2565fs
p.S2562fs
--Wang2020 T
Yuen2017 G
KMT2A     1-0143-003chr11:
118355016-118355016
GGAGTGGACTTTAAGGTAAAGGTGTTCAGTGATCATexonicDe novoframeshift insertionNM_001197104
NM_005933
c.4205_4206insAGTGGACTTTAAGGTAAAGGTGTTCAGTGATCAT
c.4205_4206insAGTGGACTTTAAGGTAAAGGTGTTCAGTGATCAT
p.R1402fs
p.R1402fs
-1.651E-5Wang2020 T
KMT2A     M21730chr11:
118376815-118376815
CTexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.C10208T
c.C10199T
p.P3403L
p.P3400L
17.23-Wang2020 T
Wang2020 T
KMT2A     09C95599chr11:
118347554-118347554
GCexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.G3191C
c.G3191C
p.R1064P
p.R1064P
21.3-Stessman2017 T
Wang2020 T
Wang2020 T
KMT2A     1458001chr11:
118352596-118352596
CTexonicDe novosynonymous SNVNM_001197104
NM_005933
c.C3801T
c.C3801T
p.V1267V
p.V1267V
--Satterstrom2020 E
KMT2A     SF0044601.p1chr11:
118373197-118373197
GAexonicDe novononsynonymous SNVNM_001197104
NM_005933
c.G6590A
c.G6581A
p.R2197H
p.R2194H
18.091.649E-5Wang2020 T
KMT2A     SF0133915.p1chr11:
118362545-118362545
CTexonicDe novostopgainNM_001197104
NM_005933
c.C4906T
c.C4897T
p.R1636X
p.R1633X
42.0-Wang2020 T
KMT2A     Husson2020:324chr11:
118376182-118376182
ACexonicnonsynonymous SNVNM_001197104
NM_005933
c.A9575C
c.A9566C
p.Q3192P
p.Q3189P
12.78-Husson2020 E
KMT2A     SF0116178.p2chr11:
118375941-118375941
AGexonicDe novononsynonymous SNVNM_001197104
NM_005933
c.A9334G
c.A9325G
p.S3112G
p.S3109G
6.582-Wang2020 T
KMT2A     203.03chr11:
118362546-118362546
GAexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.G4907A
c.G4898A
p.R1636Q
p.R1633Q
33.01.647E-5Wang2020 T
KMT2A     1-0404-003chr11:
118371709-118371710
AGAexonicDe novoframeshift deletionNM_001197104
NM_005933
c.6167delG
c.6158delG
p.R2056fs
p.R2053fs
--Wang2020 T
KMT2A     M27791chr11:
118390432-118390432
GAexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.G11246A
c.G11237A
p.R3749H
p.R3746H
22.94.942E-5Wang2020 T
Wang2020 T
KMT2A     SF0151508.p1chr11:
118360862-118360862
CTexonicDe novononsynonymous SNVNM_001197104
NM_005933
c.C4594T
c.C4594T
p.R1532C
p.R1532C
16.068.278E-6Wang2020 T
KMT2A     SF0109099.p1chr11:
118360843-118360843
GCsplicingDe novosplicing23.9-Wang2020 T
KMT2A     BK_655_01chr11:
118362546-118362546
GAexonicMaternalnonsynonymous SNVNM_001197104
NM_005933
c.G4907A
c.G4898A
p.R1636Q
p.R1633Q
33.01.647E-5Wang2020 T
Wang2020 T
KMT2A     Husson2020:291chr11:
118378325-118378325
GAsplicingPaternalsplicing21.7-Husson2020 E
KMT2A     1-0640-003chr11:
118371929-118371929
TCintronicDe novo--Yuen2017 G
KMT2A     2-1128-003chr11:
118358112-118358112
CGintronicDe novo--Yuen2016 G
KMT2A     Mahjani2021:74chr11:
118392044-118392044
TCexonicnonsynonymous SNVNM_001197104
NM_005933
c.T11555C
c.T11546C
p.I3852T
p.I3849T
18.93-Mahjani2021 E
KMT2A     84404888chr11:
118344185-118344185
AACexonicUnknownframeshift insertionNM_001197104
NM_005933
c.2312dupC
c.2312dupC
p.T771fs
p.T771fs
-3.0E-4Wang2020 T
Wang2020 T
KMT2A     60257481chr11:
118373226-118373226
CTexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.C6619T
c.C6610T
p.R2207W
p.R2204W
14.738.239E-6Wang2020 T
Wang2020 T
KMT2A     11145.p1chr11:
118344386-118344387
TGTexonicDe novoframeshift deletionNM_001197104
NM_005933
c.2513delG
c.2513delG
p.W838fs
p.W838fs
--Chan2019 GET
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
KMT2A     BK_627.02chr11:
118339545-118339545
CAexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.C488A
c.C488A
p.T163K
p.T163K
21.6-Wang2020 T
Wang2020 T
KMT2A     84168194chr11:
118363824-118363824
GAexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.G5057A
c.G5048A
p.R1686H
p.R1683H
21.8-Wang2020 T
Wang2020 T
KMT2A     80001104439chr11:
118375878-118375878
CCTexonicDe novoframeshift insertionNM_001197104
NM_005933
c.9272dupT
c.9263dupT
p.L3091fs
p.L3088fs
--Satterstrom2020 E
KMT2A     7829chr11:
118370123-118370123
CTexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.C6067T
c.C6058T
p.H2023Y
p.H2020Y
21.8-Wang2020 T
Wang2020 T
KMT2A     08C75268chr11:
118344818-118344818
TAexonicDe novononsynonymous SNVNM_001197104
NM_005933
c.T2944A
c.T2944A
p.S982T
p.S982T
6.688-Neale2012 E
Satterstrom2020 E
KMT2A     04C37123chr11:
118392019-118392019
CTexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.C11530T
c.C11521T
p.R3844W
p.R3841W
17.67-Stessman2017 T
Wang2020 T
Wang2020 T
KMT2A     04C37130chr11:
118392019-118392019
CTexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.C11530T
c.C11521T
p.R3844W
p.R3841W
17.67-Stessman2017 T
Wang2020 T
Wang2020 T
Wang2020 T
KMT2A     04C38313chr11:
118392020-118392020
GAexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.G11531A
c.G11522A
p.R3844Q
p.R3841Q
26.8-Stessman2017 T
Wang2020 T
Wang2020 T
KMT2A     AU1391302chr11:
118392020-118392020
GAexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.G11531A
c.G11522A
p.R3844Q
p.R3841Q
26.8-Stessman2017 T
Wang2020 T
Wang2020 T
Wang2020 T
KMT2A     Chan2019:3chr11:
118371709-118371710
AGAexonicDe novoframeshift deletionNM_001197104
NM_005933
c.6167delG
c.6158delG
p.R2056fs
p.R2053fs
--Chan2019 GET
KMT2A     Chan2019:1chr11:
118376930-118376931
AGAexonicDe novoframeshift deletionNM_001197104
NM_005933
c.10324delG
c.10315delG
p.A3442fs
p.A3439fs
--Chan2019 GET
KMT2A     13742.p1chr11:
118365082-118365082
CGexonicInheritednonsynonymous SNVNM_001197104
NM_005933
c.C5258G
c.C5249G
p.A1753G
p.A1750G
21.4-Chan2019 GET
KMT2A     14093.p1chr11:
118362546-118362546
GAexonicInheritednonsynonymous SNVNM_001197104
NM_005933
c.G4907A
c.G4898A
p.R1636Q
p.R1633Q
33.01.647E-5Chan2019 GET
KMT2A     Jones2012:2chr11:
118374873-118374874
TTTexonicDe novostopgainNM_001197104
NM_005933
c.8267delT
c.8258delT
p.L2756X
p.L2753X
--Chan2019 GET
KMT2A     Jones2012:1chr11:
118375412-118375416
TGTCTTexonicDe novoframeshift deletionNM_001197104
NM_005933
c.8806_8809del
c.8797_8800del
p.V2936fs
p.V2933fs
--Chan2019 GET
KMT2A     Chan2019:5chr11:
118375150-118375150
TCexonicDe novononsynonymous SNVNM_001197104
NM_005933
c.T8543C
c.T8534C
p.L2848P
p.L2845P
13.42-Chan2019 GET
KMT2A     Chan2019:4chr11:
118374301-118374303
CTGCexonicDe novoframeshift deletionNM_001197104
NM_005933
c.7695_7696del
c.7686_7687del
p.S2565fs
p.S2562fs
--Chan2019 GET
KMT2A     14535.p1chr11:
118378325-118378325
GCsplicingInheritedsplicing20.91.672E-5Chan2019 GET
KMT2A     Chan2019:6chr11:
118374702-118374702
CTexonicDe novostopgainNM_001197104
NM_005933
c.C8095T
c.C8086T
p.R2699X
p.R2696X
47.0-Chan2019 GET
KMT2A     M21633chr11:
118361991-118361991
CTexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.C4777T
c.C4777T
p.R1593C
p.R1593C
21.6-Wang2020 T
Wang2020 T
KMT2A     GX0100.p1chr11:
118353172-118353172
CTexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.C4048T
c.C4048T
p.R1350C
p.R1350C
17.31-Wang2020 T
Wang2020 T
KMT2A     Baer2018:30chr11:
118370550-118370550
GAexonicDe novononsynonymous SNVNM_001197104
NM_005933
c.G6080A
c.G6071A
p.G2027E
p.G2024E
18.15-Chan2019 GET
KMT2A     DDD4K.02892chr11:
118373178-118373178
CTexonicDe novostopgainNM_001197104
NM_005933
c.C6571T
c.C6562T
p.R2191X
p.R2188X
46.0-Chan2019 GET
KMT2A     Li2018:5chr11:
118348850-118348850
GAexonicDe novononsynonymous SNVNM_001197104
NM_005933
c.G3503A
c.G3503A
p.G1168D
p.G1168D
24.4-Chan2019 GET
KMT2A     Baer2018:31chr11:
118369155-118369155
AGexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.A5873G
c.A5864G
p.H1958R
p.H1955R
18.48-Chan2019 GET
KMT2A     SD0321.p1chr11:
118372513-118372513
GAexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.G6446A
c.G6437A
p.R2149Q
p.R2146Q
21.82.472E-5Wang2020 T
Wang2020 T
Wang2020 T
KMT2A     Mahjani2021:138chr11:
118375878-118375878
CCTexonicframeshift insertionNM_001197104
NM_005933
c.9272dupT
c.9263dupT
p.L3091fs
p.L3088fs
--Mahjani2021 E
KMT2A     M8605chr11:
118372513-118372513
GAexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.G6446A
c.G6437A
p.R2149Q
p.R2146Q
21.82.472E-5Wang2020 T
Wang2020 T
Wang2020 T
KMT2A     1339JS0028chr11:
118344818-118344818
TAexonicDe novononsynonymous SNVNM_001197104
NM_005933
c.T2944A
c.T2944A
p.S982T
p.S982T
6.688-Chan2019 GET
DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Wang2020 T
KMT2A     229.03chr11:
118362546-118362546
GAexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.G4907A
c.G4898A
p.R1636Q
p.R1633Q
33.01.647E-5Wang2020 T
Wang2020 T
KMT2A     DEASD_0323_001chr11:
118360578-118360579
ACAexonicDe novoframeshift deletionNM_001197104
NM_005933
c.4552delC
c.4552delC
p.P1518fs
p.P1518fs
--Chan2019 GET
DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
KMT2A     GD0096.p1chr11:
118390479-118390479
GAexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.G11293A
c.G11284A
p.G3765S
p.G3762S
20.7-Wang2020 T
Wang2020 T
KMT2A     M15220chr11:
118342865-118342865
CTexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.C991T
c.C991T
p.R331W
p.R331W
15.281.701E-5Wang2020 T
Wang2020 T
KMT2A     205.03chr11:
118362546-118362546
GAexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.G4907A
c.G4898A
p.R1636Q
p.R1633Q
33.01.647E-5Wang2020 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More