or
or
Exact

Results for "ADNP"

Variant Events: 107

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ADNP     BK755-01chr20:
49509094-49509094
GTexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2157A
c.C2157A
c.C2157A
c.C2157A
p.Y719X
p.Y719X
p.Y719X
p.Y719X
38.0-Wang2020 T
Wang2020 T
ADNP     GX0124.p1chr20:
49508141-49508141
TGexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A3110C
c.A3110C
c.A3110C
c.A3110C
p.E1037A
p.E1037A
p.E1037A
p.E1037A
12.49-Guo2018 T
ADNP     111294chr20:
49508751-49508755
CTTTACexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2496_2499del
c.2496_2499del
c.2496_2499del
c.2496_2499del
p.N832fs
p.N832fs
p.N832fs
p.N832fs
--Helsmoortel2014 T
ADNP     M32301chr20:
49508073-49508073
GAexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C3178T
c.C3178T
c.C3178T
c.C3178T
p.P1060S
p.P1060S
p.P1060S
p.P1060S
11.81-Guo2018 T
ADNP     035-09-110762chr20:
49508990-49508990
ACexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.T2261G
c.T2261G
c.T2261G
c.T2261G
p.L754X
p.L754X
p.L754X
p.L754X
45.0-Satterstrom2020 E
ADNP     11-08612chr20:
49510040-49510040
GTexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C1211A
c.C1211A
c.C1211A
c.C1211A
p.S404X
p.S404X
p.S404X
p.S404X
40.0-Helsmoortel2014 T
ADNP     GX0471.p1chr20:
49509666-49509666
CTexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G1585A
c.G1585A
c.G1585A
c.G1585A
p.A529T
p.A529T
p.A529T
p.A529T
15.971.648E-5Guo2018 T
ADNP     SD0091.p1chr20:
49510578-49510578
GAexonicUnknownstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C673T
c.C673T
c.C673T
c.C673T
p.R225X
p.R225X
p.R225X
p.R225X
39.0-Wang2020 T
Wang2020 T
ADNP     1050237chr20:
49509085-49509098
CATTTGCTCGTAAGCexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2153_2165del
c.2153_2165del
c.2153_2165del
c.2153_2165del
p.T718fs
p.T718fs
p.T718fs
p.T718fs
--Helsmoortel2014 T
ADNP     M30841chr20:
49508520-49508520
GAexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2731T
c.C2731T
c.C2731T
c.C2731T
p.H911Y
p.H911Y
p.H911Y
p.H911Y
4.5771.649E-5Guo2018 T
ADNP     3061-08Dchr20:
49509094-49509094
GCexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2157G
c.C2157G
c.C2157G
c.C2157G
p.Y719X
p.Y719X
p.Y719X
p.Y719X
38.0-Helsmoortel2014 T
ADNP     M12352chr20:
49508079-49508079
AGexonicUnknownnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T3172C
c.T3172C
c.T3172C
c.T3172C
p.S1058P
p.S1058P
p.S1058P
p.S1058P
5.8718.24E-6Wang2016 T
ADNP     122793chr20:
49508756-49508760
TTTAATexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2491_2494del
c.2491_2494del
c.2491_2494del
c.2491_2494del
p.L831fs
p.L831fs
p.L831fs
p.L831fs
--Helsmoortel2014 T
ADNP     07-06960chr20:
49508442-49508443
CGCexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.2808delC
c.2808delC
c.2808delC
c.2808delC
p.Y936X
p.Y936X
p.Y936X
p.Y936X
--Helsmoortel2014 T
ADNP     HN0125.p1chr20:
49507974-49507974
CTexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G3277A
c.G3277A
c.G3277A
c.G3277A
p.A1093T
p.A1093T
p.A1093T
p.A1093T
0.019-Guo2018 T
ADNP     2376chr20:
49508756-49508760
TTTAATexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2491_2494del
c.2491_2494del
c.2491_2494del
c.2491_2494del
p.L831fs
p.L831fs
p.L831fs
p.L831fs
--Helsmoortel2014 T
ADNP     2533chr20:
49509321-49509321
GAexonicUnknownstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C1930T
c.C1930T
c.C1930T
c.C1930T
p.R644X
p.R644X
p.R644X
p.R644X
42.0-Helsmoortel2014 T
ADNP     13545.p1 Complex Event; expand row to view variants  De novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.2156dupA
c.2156dupA
c.2156dupA
c.2156dupA
p.Y719_E720delinsX
p.Y719_E720delinsX
p.Y719_E720delinsX
p.Y719_E720delinsX
--Helsmoortel2014 T
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
ADNP     GX0202.p1chr20:
49510928-49510928
TCexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A323G
c.A323G
c.A323G
c.A323G
p.N108S
p.N108S
p.N108S
p.N108S
6.793-Guo2018 T
ADNP     M8878chr20:
49508151-49508151
CTexonicDe novononsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G3100A
c.G3100A
c.G3100A
c.G3100A
p.G1034R
p.G1034R
p.G1034R
p.G1034R
17.678.238E-5Wang2016 T
ADNP     GX0435.p1chr20:
49510592-49510592
CTexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G659A
c.G659A
c.G659A
c.G659A
p.S220N
p.S220N
p.S220N
p.S220N
4.0132.471E-5Guo2018 T
ADNP     AU4242302chr20:
49505407-49505407
CTdownstreamDe novo--Yuen2017 G
ADNP     SD0063.p1chr20:
49508024-49508024
TCexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A3227G
c.A3227G
c.A3227G
c.A3227G
p.Q1076R
p.Q1076R
p.Q1076R
p.Q1076R
11.65-Guo2018 T
ADNP     M15242chr20:
49507974-49507974
CTexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G3277A
c.G3277A
c.G3277A
c.G3277A
p.A1093T
p.A1093T
p.A1093T
p.A1093T
0.019-Guo2018 T
Wang2016 T
ADNP     M01853 Complex Event; expand row to view variants  Unknown, Maternalframeshift insertion, nonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
NM_001282532
NM_181442
NM_015339
NM_001282531
c.3047dupA
c.3047dupA
c.3047dupA
c.3047dupA
c.G3048C
c.G3048C
c.G3048C
c.G3048C
p.K1016fs
p.K1016fs
p.K1016fs
p.K1016fs
p.K1016N
p.K1016N
p.K1016N
p.K1016N
11.658.261E-6Guo2018 T
Wang2016 T
Wang2020 T
Wang2020 T
ADNP     M27882chr20:
49510619-49510619
ATexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.T632A
c.T632A
c.T632A
c.T632A
p.L211X
p.L211X
p.L211X
p.L211X
39.0-Guo2018 T
Stessman2017 T
Wang2016 T
Wang2020 T
Wang2020 T
ADNP     SF0086863.p1chr20:
49509094-49509094
GCexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2157G
c.C2157G
c.C2157G
c.C2157G
p.Y719X
p.Y719X
p.Y719X
p.Y719X
38.0-Wang2020 T
ADNP     SF0000938.p1chr20:
49508963-49508964
GAGexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2287delT
c.2287delT
c.2287delT
c.2287delT
p.S763fs
p.S763fs
p.S763fs
p.S763fs
--Wang2020 T
ADNP     HEN0265.p1chr20:
49510232-49510232
CAexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G1019T
c.G1019T
c.G1019T
c.G1019T
p.G340V
p.G340V
p.G340V
p.G340V
8.1873.295E-5Guo2018 T
ADNP     GX0558.p1chr20:
49509029-49509029
ACexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T2222G
c.T2222G
c.T2222G
c.T2222G
p.F741C
p.F741C
p.F741C
p.F741C
12.21-Guo2018 T
ADNP     HEN0250.p1chr20:
49511018-49511018
GAexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C233T
c.C233T
c.C233T
c.C233T
p.A78V
p.A78V
p.A78V
p.A78V
12.738.454E-6Guo2018 T
ADNP     BK_673.01chr20:
49510963-49510964
GAGexonicUnknownframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.287delT
c.287delT
c.287delT
c.287delT
p.V96fs
p.V96fs
p.V96fs
p.V96fs
--Wang2020 T
ADNP     SF0036574.p1chr20:
49510203-49510205
CCACexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1046_1047del
c.1046_1047del
c.1046_1047del
c.1046_1047del
p.L349fs
p.L349fs
p.L349fs
p.L349fs
--Wang2020 T
ADNP     SF0036637.p1chr20:
49509716-49509716
ACexonicDe novononsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T1535G
c.T1535G
c.T1535G
c.T1535G
p.L512R
p.L512R
p.L512R
p.L512R
17.32-Wang2020 T
ADNP     SF0075687.p1chr20:
49510708-49510712
CCTAACexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.539_542del
c.539_542del
c.539_542del
c.539_542del
p.V180fs
p.V180fs
p.V180fs
p.V180fs
--Wang2020 T
ADNP     SF0131947.p1chr20:
49510393-49510398
CCTTGGCexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.853_857del
c.853_857del
c.853_857del
c.853_857del
p.P285fs
p.P285fs
p.P285fs
p.P285fs
--Wang2020 T
ADNP     SF0081420.p1chr20:
49509094-49509094
GTexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2157A
c.C2157A
c.C2157A
c.C2157A
p.Y719X
p.Y719X
p.Y719X
p.Y719X
38.0-Wang2020 T
ADNP     SF0041760.p1chr20:
49509094-49509094
GTexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2157A
c.C2157A
c.C2157A
c.C2157A
p.Y719X
p.Y719X
p.Y719X
p.Y719X
38.0-Wang2020 T
ADNP     SF0036637.p1chr20:
49509711-49509711
ACexonicDe novononsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T1540G
c.T1540G
c.T1540G
c.T1540G
p.C514G
p.C514G
p.C514G
p.C514G
16.78-Wang2020 T
ADNP     SF0042813.p1chr20:
49509683-49509683
TGexonicDe novononsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A1568C
c.A1568C
c.A1568C
c.A1568C
p.D523A
p.D523A
p.D523A
p.D523A
17.1-Wang2020 T
ADNP     M16139chr20:
49510040-49510040
GAexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C1211T
c.C1211T
c.C1211T
c.C1211T
p.S404L
p.S404L
p.S404L
p.S404L
8.4788.238E-6Guo2018 T
Wang2016 T
ADNP     M15147chr20:
49508976-49508976
GAexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2275T
c.C2275T
c.C2275T
c.C2275T
p.H759Y
p.H759Y
p.H759Y
p.H759Y
7.644-Guo2018 T
Wang2016 T
ADNP     ASD-821chr20:
49520532-49520532
AGexonicDe novononsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T2C
c.T2C
c.T2C
c.T2C
p.M1T
p.M1T
p.M1T
p.M1T
24.3-Du2018 E
ADNP     SF0104108.p1chr20:
49510888-49510890
CAACexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.361_362del
c.361_362del
c.361_362del
c.361_362del
p.L121fs
p.L121fs
p.L121fs
p.L121fs
--Wang2020 T
ADNP     D’Gama2015:797chr20:
49507970-49507970
CAexonicUnknownnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G3281T
c.G3281T
c.G3281T
c.G3281T
p.G1094V
p.G1094V
p.G1094V
p.G1094V
16.38.633E-6D’Gama2015 T
ADNP     SF0130990.p1chr20:
49510708-49510712
CCTAACexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.539_542del
c.539_542del
c.539_542del
c.539_542del
p.V180fs
p.V180fs
p.V180fs
p.V180fs
--Wang2020 T
ADNP     SF0103630.p3chr20:
49510998-49510998
AGexonicDe novononsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T253C
c.T253C
c.T253C
c.T253C
p.F85L
p.F85L
p.F85L
p.F85L
14.19-Wang2020 T
ADNP     SF0082696.p1chr20:
49510916-49510916
CCTexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.334_335insA
c.334_335insA
c.334_335insA
c.334_335insA
p.C112_T113delinsX
p.C112_T113delinsX
p.C112_T113delinsX
p.C112_T113delinsX
--Wang2020 T
ADNP     M30823chr20:
49509029-49509029
ACexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T2222G
c.T2222G
c.T2222G
c.T2222G
p.F741C
p.F741C
p.F741C
p.F741C
12.21-Guo2018 T
ADNP     GX0033.p1chr20:
49508505-49508505
TCexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A2746G
c.A2746G
c.A2746G
c.A2746G
p.I916V
p.I916V
p.I916V
p.I916V
0.578-Guo2018 T
ADNP     GX0091.p1chr20:
49508136-49508136
AGexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T3115C
c.T3115C
c.T3115C
c.T3115C
p.F1039L
p.F1039L
p.F1039L
p.F1039L
13.95-Guo2018 T
ADNP     GX0403.p1chr20:
49508393-49508393
GAexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2858T
c.C2858T
c.C2858T
c.C2858T
p.S953F
p.S953F
p.S953F
p.S953F
11.59-Guo2018 T
ADNP     GX0309.p1chr20:
49508318-49508318
GAexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2933T
c.C2933T
c.C2933T
c.C2933T
p.S978F
p.S978F
p.S978F
p.S978F
17.38-Guo2018 T
ADNP     SD0087.p1chr20:
49509095-49509096
TATexonicUnknownframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2155delT
c.2155delT
c.2155delT
c.2155delT
p.Y719fs
p.Y719fs
p.Y719fs
p.Y719fs
--Guo2018 T
Wang2020 T
Wang2020 T
ADNP     AU024104chr20:
49537528-49537528
GAintronicDe novo--Yuen2017 G
ADNP     M27874chr20:
49510010-49510010
TAexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A1241T
c.A1241T
c.A1241T
c.A1241T
p.Q414L
p.Q414L
p.Q414L
p.Q414L
14.171.648E-5Guo2018 T
Wang2016 T
ADNP     M8121chr20:
49507974-49507974
CTexonicUnknownnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G3277A
c.G3277A
c.G3277A
c.G3277A
p.A1093T
p.A1093T
p.A1093T
p.A1093T
0.019-Wang2016 T
ADNP     SP0001740chr20:
49508976-49509001
GACCCTTGGGGTCTAAAGCTAAAACAGexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2250_2274del
c.2250_2274del
c.2250_2274del
c.2250_2274del
p.V750fs
p.V750fs
p.V750fs
p.V750fs
--Feliciano2019 E
ADNP     AU019604chr20:
49508203-49508203
CCTexonicUnknown, Maternalframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.3047dupA
c.3047dupA
c.3047dupA
c.3047dupA
p.K1016fs
p.K1016fs
p.K1016fs
p.K1016fs
-8.261E-6Wang2020 T
Wang2020 T
ADNP     08C76513chr20:
49508081-49508081
ATexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.T3170A
c.T3170A
c.T3170A
c.T3170A
p.L1057X
p.L1057X
p.L1057X
p.L1057X
45.0-Satterstrom2020 E
ADNP     12130.p1chr20:
49510027-49510029
CTTCexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1222_1223del
c.1222_1223del
c.1222_1223del
c.1222_1223del
p.K408fs
p.K408fs
p.K408fs
p.K408fs
--Dong2014 E
Helsmoortel2014 T
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
O’Roak2012b E
O’Roak2014 T
Wang2020 T
Wilfert2021 G
Willsey2013 E
ADNP     1-0382-003chr20:
49507667-49507667
TCUTR3De novo--Yuen2017 G
ADNP     GX0639.p1chr20:
49508869-49508869
CTexonicUnknownstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.G2382A
c.G2382A
c.G2382A
c.G2382A
p.W794X
p.W794X
p.W794X
p.W794X
46.0-Wang2020 T
Wang2020 T
ADNP     HEN0007.p1chr20:
49508932-49508932
CCTexonicUnknownframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2318dupA
c.2318dupA
c.2318dupA
c.2318dupA
p.K773fs
p.K773fs
p.K773fs
p.K773fs
--Wang2020 T
Wang2020 T
ADNP     12707.p1chr20:
49507972-49507972
GGGGexonicMaternalframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.3278_3279insCC
c.3278_3279insCC
c.3278_3279insCC
c.3278_3279insCC
p.A1093fs
p.A1093fs
p.A1093fs
p.A1093fs
--O’Roak2012a T
ADNP     M03533chr20:
49508963-49508963
GAexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2288T
c.C2288T
c.C2288T
c.C2288T
p.S763F
p.S763F
p.S763F
p.S763F
31.0-Guo2018 T
Wang2016 T
Wang2020 T
Wang2020 T
ADNP     M16274chr20:
49508291-49508291
TCexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A2960G
c.A2960G
c.A2960G
c.A2960G
p.N987S
p.N987S
p.N987S
p.N987S
11.081.648E-5Guo2018 T
Wang2016 T
ADNP     M15199chr20:
49508199-49508199
TCexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A3052G
c.A3052G
c.A3052G
c.A3052G
p.T1018A
p.T1018A
p.T1018A
p.T1018A
0.1948.237E-6Guo2018 T
Wang2016 T
ADNP     M08121chr20:
49507974-49507974
CTexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G3277A
c.G3277A
c.G3277A
c.G3277A
p.A1093T
p.A1093T
p.A1093T
p.A1093T
0.019-Guo2018 T
ADNP     M18390chr20:
49508283-49508283
CTexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G2968A
c.G2968A
c.G2968A
c.G2968A
p.E990K
p.E990K
p.E990K
p.E990K
15.847.414E-5Guo2018 T
Wang2016 T
ADNP     SX0083.p1chr20:
49510358-49510358
ACexonicUnknownstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.T893G
c.T893G
c.T893G
c.T893G
p.L298X
p.L298X
p.L298X
p.L298X
40.0-Wang2020 T
Wang2020 T
ADNP     HN0024.p1chr20:
49509063-49509063
GAexonicUnknownstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2188T
c.C2188T
c.C2188T
c.C2188T
p.R730X
p.R730X
p.R730X
p.R730X
41.0-Wang2020 T
Wang2020 T
ADNP     5941chr20:
49509094-49509094
GCexonicUnknownstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2157G
c.C2157G
c.C2157G
c.C2157G
p.Y719X
p.Y719X
p.Y719X
p.Y719X
38.0-Wang2020 T
Wang2020 T
ADNP     08C73958chr20:
49510224-49510224
CCAexonicDe novoframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1026dupT
c.1026dupT
c.1026dupT
c.1026dupT
p.V343fs
p.V343fs
p.V343fs
p.V343fs
--Satterstrom2020 E
ADNP     M03713chr20:
49510033-49510033
CA/CexonicPaternal--Guo2018 T
ADNP     M08083chr20:
49508708-49508708
TCexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A2543G
c.A2543G
c.A2543G
c.A2543G
p.N848S
p.N848S
p.N848S
p.N848S
16.12-Guo2018 T
ADNP     62538053chr20:
49509963-49509963
CCAexonicUnknownframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1287dupT
c.1287dupT
c.1287dupT
c.1287dupT
p.A430fs
p.A430fs
p.A430fs
p.A430fs
--Wang2020 T
Wang2020 T
ADNP     85803369chr20:
49509847-49509849
TTCTexonicUnknownframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1402_1403del
c.1402_1403del
c.1402_1403del
c.1402_1403del
p.E468fs
p.E468fs
p.E468fs
p.E468fs
--Wang2020 T
Wang2020 T
ADNP     COL1111.03chr20:
49510027-49510029
CTTCexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1222_1223del
c.1222_1223del
c.1222_1223del
c.1222_1223del
p.K408fs
p.K408fs
p.K408fs
p.K408fs
--Satterstrom2020 E
ADNP     G01-GEA-207-HIchr20:
49508823-49508827
TCTTCTexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2424_2427del
c.2424_2427del
c.2424_2427del
c.2424_2427del
p.R808fs
p.R808fs
p.R808fs
p.R808fs
--Satterstrom2020 E
ADNP     M13413chr20:
49508156-49508156
GCexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C3095G
c.C3095G
c.C3095G
c.C3095G
p.S1032C
p.S1032C
p.S1032C
p.S1032C
15.468.238E-5Wang2016 T
ADNP     1-0353-003chr20:
49508081-49508081
ATexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.T3170A
c.T3170A
c.T3170A
c.T3170A
p.L1057X
p.L1057X
p.L1057X
p.L1057X
45.0-Wang2020 T
Yuen2017 G
ADNP     M17485chr20:
49508436-49508436
TGexonicUnknownnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A2815C
c.A2815C
c.A2815C
c.A2815C
p.I939L
p.I939L
p.I939L
p.I939L
0.1172.0E-4Wang2016 T
ADNP     IGM1648671chr20:
49510505-49510505
TCexonicDe novononsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A746G
c.A746G
c.A746G
c.A746G
p.Y249C
p.Y249C
p.Y249C
p.Y249C
11.49-Satterstrom2020 E
ADNP     211-5367-3chr20:
49508081-49508081
ATexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.T3170A
c.T3170A
c.T3170A
c.T3170A
p.L1057X
p.L1057X
p.L1057X
p.L1057X
45.0-O’Roak2014 T
Stessman2017 T
Stessman2017 T
Wang2020 T
Wang2020 T
ADNP     1986-24087chr20:
49508452-49508453
ACAexonicframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2798delG
c.2798delG
c.2798delG
c.2798delG
p.G933fs
p.G933fs
p.G933fs
p.G933fs
--Callaghan2019 G
ADNP     566.03chr20:
49510911-49510912
AGAexonicUnknownframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.339delC
c.339delC
c.339delC
c.339delC
p.T113fs
p.T113fs
p.T113fs
p.T113fs
--Wang2020 T
Wang2020 T
ADNP     569.03chr20:
49510203-49510205
CCACexonicUnknownframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1046_1047del
c.1046_1047del
c.1046_1047del
c.1046_1047del
p.L349fs
p.L349fs
p.L349fs
p.L349fs
--Wang2020 T
Wang2020 T
ADNP     2-0028-003 Complex Event; expand row to view variants  De novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
NM_001282532
NM_181442
NM_015339
NM_001282531
c.1035_1038del
c.1035_1038del
c.1035_1038del
c.1035_1038del
c.1031_1034del
c.1031_1034del
c.1031_1034del
c.1031_1034del
p.Q345fs
p.Q345fs
p.Q345fs
p.Q345fs
p.G344fs
p.G344fs
p.G344fs
p.G344fs
--Wang2020 T
Yuen2016 G
Yuen2017 G
ADNP     Cherot2017:1chr20:
49510578-49510578
GAexonicUnknownstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C673T
c.C673T
c.C673T
c.C673T
p.R225X
p.R225X
p.R225X
p.R225X
39.0-Cherot2017 E
ADNP     ASC_CA_75_Achr20:
49508963-49508963
GGAexonicDe novoframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2287dupT
c.2287dupT
c.2287dupT
c.2287dupT
p.S763fs
p.S763fs
p.S763fs
p.S763fs
--Satterstrom2020 E
ADNP     HEN0171.p1chr20:
49508283-49508283
CTexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G2968A
c.G2968A
c.G2968A
c.G2968A
p.E990K
p.E990K
p.E990K
p.E990K
15.847.414E-5Guo2018 T
ADNP     HEN0258.p1chr20:
49510164-49510164
ATexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T1087A
c.T1087A
c.T1087A
c.T1087A
p.S363T
p.S363T
p.S363T
p.S363T
11.02-Guo2018 T
ADNP     SX0011.p1chr20:
49508442-49508442
CTexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G2809A
c.G2809A
c.G2809A
c.G2809A
p.E937K
p.E937K
p.E937K
p.E937K
0.4857.419E-5Guo2018 T
ADNP     Mahjani2021:95chr20:
49508932-49508934
CTTCexonicframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2317_2318del
c.2317_2318del
c.2317_2318del
c.2317_2318del
p.K773fs
p.K773fs
p.K773fs
p.K773fs
--Mahjani2021 E
ADNP     GX0536.p1chr20:
49510604-49510604
CTexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G647A
c.G647A
c.G647A
c.G647A
p.R216Q
p.R216Q
p.R216Q
p.R216Q
9.9748.238E-6Guo2018 T
ADNP     DEASD_0149_001chr20:
49508382-49508386
CCTCACexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2865_2868del
c.2865_2868del
c.2865_2868del
c.2865_2868del
p.S955fs
p.S955fs
p.S955fs
p.S955fs
--DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
ADNP     DEASD_0076_001chr20:
49510602-49510610
CTCGGGCATCexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.641_648del
c.641_648del
c.641_648del
c.641_648del
p.N214fs
p.N214fs
p.N214fs
p.N214fs
--DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
ADNP     BK_673_01chr20:
49510963-49510964
GAGexonicUnknownframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.287delT
c.287delT
c.287delT
c.287delT
p.V96fs
p.V96fs
p.V96fs
p.V96fs
--Wang2020 T
ADNP     213-8763-103chr20:
49510224-49510224
CCAexonicDe novoframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1026dupT
c.1026dupT
c.1026dupT
c.1026dupT
p.V343fs
p.V343fs
p.V343fs
p.V343fs
--O’Roak2014 T
ADNP     BK_683_01chr20:
49510149-49510149
GAexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C1102T
c.C1102T
c.C1102T
c.C1102T
p.Q368X
p.Q368X
p.Q368X
p.Q368X
41.0-Wang2020 T
Wang2020 T
ADNP     BK767-01chr20:
49518564-49518564
GGTexonicDe novoframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.190dupA
c.190dupA
c.190dupA
c.190dupA
p.T64fs
p.T64fs
p.T64fs
p.T64fs
--Wang2020 T
Wang2020 T
ADNP     BK_720_01chr20:
49510431-49510432
TGTexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.819delC
c.819delC
c.819delC
c.819delC
p.P273fs
p.P273fs
p.P273fs
p.P273fs
--Wang2020 T
Wang2020 T
ADNP     56744chr20:
49518645-49518645
TAexonicUnknownnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A110T
c.A110T
c.A110T
c.A110T
p.D37V
p.D37V
p.D37V
p.D37V
27.4-Stessman2017 T
Wang2020 T
Wang2020 T
ADNP     TIGER_T204-03chr20:
49509094-49509094
GTexonicUnknown, De novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2157A
c.C2157A
c.C2157A
c.C2157A
p.Y719X
p.Y719X
p.Y719X
p.Y719X
38.0-Wang2020 T
Wang2020 T
Wang2020 T
ADNP     M8258chr20:
49508079-49508079
AGexonicUnknownnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T3172C
c.T3172C
c.T3172C
c.T3172C
p.S1058P
p.S1058P
p.S1058P
p.S1058P
5.8718.24E-6Wang2016 T
ADNP     BK_714_01chr20:
49508751-49508755
CTTTACexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2496_2499del
c.2496_2499del
c.2496_2499del
c.2496_2499del
p.N832fs
p.N832fs
p.N832fs
p.N832fs
--Wang2020 T
Wang2020 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More