or
or
Exact

Results for "DYRK1A"

Variant Events: 65

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DYRK1A     JS0001.p1chr21:
38850489-38850489
CGexonicMaternalnonsynonymous SNVNM_001396
NM_130438
NM_101395
c.C214G
c.C214G
c.C214G
p.P72A
p.P72A
p.P72A
14.36-Guo2018 T
DYRK1A     iHART3005chr21:
38850482-38850482
GAsplicingPaternalsplicing20.3-Ruzzo2019 G
DYRK1A     SF0018047.p1chr21:
38852950-38852950
CCAexonicDe novoframeshift insertionNM_001396
NM_130436
NM_130438
NM_101395
c.339dupA
c.312dupA
c.339dupA
c.339dupA
p.A113fs
p.A104fs
p.A113fs
p.A113fs
--Wang2020 T
DYRK1A     M13341chr21:
38878450-38878450
CTexonicPaternalnonsynonymous SNVNM_001396
NM_130436
NM_101395
c.C1595T
c.C1568T
c.C1595T
p.T532M
p.T523M
p.T532M
34.01.0E-4Guo2018 T
Wang2016 T
DYRK1A     SF0076309.p1chr21:
38865466-38865466
GAsplicingDe novosplicing28.2-Wang2020 T
DYRK1A     AU048204chr21:
38862503-38862503
CTexonicUnknown, De novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C691T
c.C664T
c.C691T
c.C691T
p.R231X
p.R222X
p.R231X
p.R231X
50.0-Stessman2017 T
Wang2020 T
Wang2020 T
Wang2020 T
DYRK1A     YN0002.p1chr21:
38884422-38884422
GAexonicMaternalnonsynonymous SNVNM_001396
NM_130436
c.G1880A
c.G1853A
p.R627Q
p.R618Q
16.143.296E-5Guo2018 T
DYRK1A     SF0093881.p1chr21:
38862575-38862575
CTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C763T
c.C736T
c.C763T
c.C763T
p.R255X
p.R246X
p.R255X
p.R255X
50.0-Wang2020 T
DYRK1A     M20274chr21:
38853069-38853069
GTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.G457T
c.G430T
c.G457T
c.G457T
p.E153X
p.E144X
p.E153X
p.E153X
49.0-Guo2018 T
Stessman2017 T
Stessman2017 T
Wang2016 T
Wang2020 T
Wang2020 T
DYRK1A     13552.p1 Complex Event; expand row to view variants  De novoframeshift deletionNM_001396
NM_130436
NM_130438
NM_101395
NM_001396
NM_130436
NM_130438
NM_101395
NM_001396
NM_130436
NM_130438
NM_101395
c.1488delC
c.1461delC
c.1488delC
c.1488delC
c.1489delC
c.1462delC
c.1489delC
c.1489delC
c.1491delC
c.1464delC
c.1491delC
c.1491delC
p.S496fs
p.S487fs
p.S496fs
p.S496fs
p.P497fs
p.P488fs
p.P497fs
p.P497fs
p.P497fs
p.P488fs
p.P497fs
p.P497fs
--Dong2014 E
Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Willsey2013 E
vanBon2015 T
DYRK1A     12099.p1 Complex Event; expand row to view variants  De novoframeshift deletionNM_001396
NM_130436
NM_130438
NM_101395
NM_001396
NM_130436
NM_130438
NM_101395
c.142_143del
c.142_143del
c.142_143del
c.142_143del
c.143_144del
c.143_144del
c.143_144del
c.143_144del
p.I48fs
p.I48fs
p.I48fs
p.I48fs
p.I48fs
p.I48fs
p.I48fs
p.I48fs
--Dong2014 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
Willsey2013 E
vanBon2015 T
DYRK1A     M12327chr21:
38877659-38877659
GAexonicUnknown, De novononsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.G1313A
c.G1286A
c.G1313A
c.G1313A
p.R438H
p.R429H
p.R438H
p.R438H
27.5-Guo2018 T
Li2017 T
Stessman2017 T
Wang2016 T
Wang2020 T
Wang2020 T
DYRK1A     M10138chr21:
38853100-38853100
CGexonicMaternalnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.C488G
c.C461G
c.C488G
c.C488G
p.S163C
p.S154C
p.S163C
p.S163C
27.6-Guo2018 T
Wang2016 T
DYRK1A     HN0026.p1chr21:
38862503-38862503
CTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C691T
c.C664T
c.C691T
c.C691T
p.R231X
p.R222X
p.R231X
p.R231X
50.0-Guo2018 T
Wang2020 T
Wang2020 T
DYRK1A     Stessman2017:ASD_1448chr21:
38865349-38865349
CTexonicUnknownnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.C982T
c.C955T
c.C982T
c.C982T
p.R328W
p.R319W
p.R328W
p.R328W
34.0-Stessman2017 T
DYRK1A     BK_606.02chr21:
38850501-38850501
AATexonicPaternalframeshift insertionNM_001396
NM_130438
NM_101395
c.227dupT
c.227dupT
c.227dupT
p.M76fs
p.M76fs
p.M76fs
--Wang2020 T
Wang2020 T
DYRK1A     11-12536chr21:
38850482-38850482
GAsplicingUnknown, Maternalsplicing20.3-Wang2020 T
Wang2020 T
Wang2020 T
DYRK1A     2-0286-003chr21:
38986964-38986964
GGTCTGTGTATGCGTGTGTGTATGCAintergenicDe novo--Yuen2017 G
DYRK1A     11-21295chr21:
38850482-38850482
GAsplicingUnknown, Maternalsplicing20.3-Wang2020 T
Wang2020 T
Wang2020 T
DYRK1A     Husson2020:47chr21:
38862575-38862575
CTexonicstopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C763T
c.C736T
c.C763T
c.C763T
p.R255X
p.R246X
p.R255X
p.R255X
50.0-Husson2020 E
DYRK1A     M3543chr21:
38845108-38845108
CGexonicUnknownnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.C133G
c.C133G
c.C133G
c.C133G
p.Q45E
p.Q45E
p.Q45E
p.Q45E
22.9-Wang2016 T
DYRK1A     M31009chr21:
38878489-38878489
CTexonicMaternalnonsynonymous SNVNM_001396
NM_130436
NM_101395
c.C1634T
c.C1607T
c.C1634T
p.A545V
p.A536V
p.A545V
34.08.32E-6Guo2018 T
DYRK1A     11-12535chr21:
38850482-38850482
GAsplicingMaternalsplicing20.3-Wang2020 T
Wang2020 T
DYRK1A     HN0091.p1chr21:
38850543-38850543
AGexonicMaternalnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.A268G
c.A241G
c.A268G
c.A268G
p.T90A
p.T81A
p.T90A
p.T90A
16.032.472E-5Guo2018 T
DYRK1A     M21761chr21:
38865398-38865398
TCexonicMaternalnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.T1031C
c.T1004C
c.T1031C
c.T1031C
p.M344T
p.M335T
p.M344T
p.M344T
26.12.471E-5Guo2018 T
Wang2016 T
DYRK1A     M16139chr21:
38868526-38868526
CGexonicPaternalnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.C1205G
c.C1178G
c.C1205G
c.C1205G
p.T402S
p.T393S
p.T402S
p.T402S
9.1827.452E-5Wang2016 T
DYRK1A     M17694chr21:
38868526-38868526
CGexonicPaternalnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.C1205G
c.C1178G
c.C1205G
c.C1205G
p.T402S
p.T393S
p.T402S
p.T402S
9.1827.452E-5Wang2016 T
DYRK1A     1-0224-004chr21:
38961490-38961490
GAintergenicDe novo--Yuen2017 G
DYRK1A     546.03chr21:
38845116-38845118
CATCexonicDe novoframeshift deletionNM_001396
NM_130436
NM_130438
NM_101395
c.142_143del
c.142_143del
c.142_143del
c.142_143del
p.I48fs
p.I48fs
p.I48fs
p.I48fs
--Wang2020 T
Wang2020 T
DYRK1A     544.03chr21:
38865466-38865466
GAsplicingDe novosplicing28.2-Wang2020 T
Wang2020 T
DYRK1A     1-0882-003chr21:
38933426-38933426
CTintergenicDe novo--Yuen2017 G
DYRK1A     M26773chr21:
38878405-38878405
GTexonicPaternalnonsynonymous SNVNM_001396
NM_130436
NM_101395
c.G1550T
c.G1523T
c.G1550T
p.G517V
p.G508V
p.G517V
25.5-Guo2018 T
Wang2016 T
DYRK1A     BK_642.01chr21:
38877755-38877755
CTexonicUnknownnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.C1409T
c.C1382T
c.C1409T
c.C1409T
p.P470L
p.P461L
p.P470L
p.P470L
34.0-Wang2020 T
Wang2020 T
DYRK1A     HEN0102.p1chr21:
38878525-38878526
AGAexonicDe novoframeshift deletionNM_001396
NM_130436
NM_101395
c.1671delG
c.1644delG
c.1671delG
p.Q557fs
p.Q548fs
p.Q557fs
--Guo2018 T
Wang2020 T
Wang2020 T
DYRK1A     553.03chr21:
38877833-38877834
GCGexonicDe novoframeshift deletionNM_001396
NM_130436
NM_130438
NM_101395
c.1488delC
c.1461delC
c.1488delC
c.1488delC
p.S496fs
p.S487fs
p.S496fs
p.S496fs
--Wang2020 T
Wang2020 T
DYRK1A     AU3638302chr21:
38973654-38973655
TCTCCintergenicDe novo--Yuen2017 G
DYRK1A     7-0255-003chr21:
38934134-38934134
CAintergenicDe novo--Yuen2017 G
DYRK1A     13890.p1chr21:
38865466-38865466
GAsplicingDe novosplicing28.2-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
O’Roak2012a T
O’Roak2012b E
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
Willsey2013 E
vanBon2015 T
DYRK1A     13256.p1chr21:
38877891-38877906
AGGTCTGTGCTGCTGCAexonicDe novoframeshift deletionNM_001396
NM_130436
NM_130438
NM_101395
c.1546_1546del
c.1519_1519del
c.1546_1546del
c.1546_1546del
p.G516fs
p.G507fs
p.G516fs
p.G516fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
DYRK1A     1-0640-003chr21:
38931481-38931481
CAintergenicDe novo--Yuen2017 G
DYRK1A     HEN0229.p1chr21:
38878564-38878564
CTexonicPaternalnonsynonymous SNVNM_101395c.C1709Tp.A570V14.38-Guo2018 T
DYRK1A     UMCN 2chr21:
38877584-38877584
AGsplicingDe novosplicing11.47-vanBon2015 T
DYRK1A     Murdoch CRIchr21:
38850482-38850482
GAsplicingInheritedsplicing20.3-vanBon2015 T
DYRK1A     1-0150-004chr21:
38965489-38965491
TGATintergenicDe novo--Yuen2017 G
DYRK1A     ASD038chr21:
38858853-38858853
CTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C601T
c.C574T
c.C601T
c.C601T
p.Q201X
p.Q192X
p.Q201X
p.Q201X
48.0-Tran2020 E
Wu2019 E
DYRK1A     TAS_F0134Ychr21:
38884702-38884702
CAexonicDe novostopgainNM_001396
NM_130436
c.C2160A
c.C2133A
p.Y720X
p.Y711X
49.0-Satterstrom2020 E
DYRK1A     GF2852chr21:
38852979-38852979
CTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C367T
c.C340T
c.C367T
c.C367T
p.Q123X
p.Q114X
p.Q123X
p.Q123X
48.0-vanBon2015 T
DYRK1A     Lim2017:6239chr21:
38865466-38865466
GAsplicingDe novosplicing28.2-Lim2017 E
DYRK1A     Li2017:20274chr21:
38853069-38853069
GTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.G457T
c.G430T
c.G457T
c.G457T
p.E153X
p.E144X
p.E153X
p.E153X
49.0-Li2017 T
DYRK1A     M23240chr21:
38865398-38865398
TCexonicUnknownnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.T1031C
c.T1004C
c.T1031C
c.T1031C
p.M344T
p.M335T
p.M344T
p.M344T
26.12.471E-5Wang2016 T
DYRK1A     1-0233-004chr21:
38960115-38960115
CAintergenicDe novo--Yuen2017 G
DYRK1A     ASDchr21:
38865349-38865349
CTexonicUnknownnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.C982T
c.C955T
c.C982T
c.C982T
p.R328W
p.R319W
p.R328W
p.R328W
34.0-Wang2020 T
Wang2020 T
DYRK1A     370627chr21:
38865398-38865398
TAexonicUnknownnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.T1031A
c.T1004A
c.T1031A
c.T1031A
p.M344K
p.M335K
p.M344K
p.M344K
33.0-Wang2020 T
Wang2020 T
DYRK1A     2-1509-003chr21:
38781371-38781371
CTintronicDe novo--Yuen2017 G
DYRK1A     AU3610302chr21:
38879377-38879377
TGintronicDe novo--Yuen2017 G
DYRK1A     M30369chr21:
38877632-38877632
TCexonicPaternalnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.T1286C
c.T1259C
c.T1286C
c.T1286C
p.V429A
p.V420A
p.V429A
p.V429A
27.81.649E-5Guo2018 T
DYRK1A     HN0045.p1chr21:
38878596-38878596
GTexonicPaternalnonsynonymous SNVNM_101395c.G1741Tp.V581L11.67-Guo2018 T
DYRK1A     1-0862-003chr21:
38812845-38812847
CTACintronicDe novo--Yuen2017 G
DYRK1A     M26749chr21:
38878594-38878594
ATexonicPaternalnonsynonymous SNVNM_101395c.A1739Tp.Q580L11.44-Guo2018 T
Wang2016 T
DYRK1A     M23840chr21:
38878594-38878594
ATexonicPaternalnonsynonymous SNVNM_101395c.A1739Tp.Q580L11.44-Guo2018 T
DYRK1A     M03543chr21:
38845108-38845108
CGexonicPaternalnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.C133G
c.C133G
c.C133G
c.C133G
p.Q45E
p.Q45E
p.Q45E
p.Q45E
22.9-Guo2018 T
DYRK1A     1-0150-003chr21:
38965489-38965491
TGATintergenicDe novo--Yuen2017 G
DYRK1A     10C108344chr21:
38877655-38877655
CTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C1309T
c.C1282T
c.C1309T
c.C1309T
p.R437X
p.R428X
p.R437X
p.R437X
50.0-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Wang2020 T
DYRK1A     M32128chr21:
38878489-38878489
CTexonicPaternalnonsynonymous SNVNM_001396
NM_130436
NM_101395
c.C1634T
c.C1607T
c.C1634T
p.A545V
p.A536V
p.A545V
34.08.32E-6Guo2018 T
DYRK1A     3-0169-000chr21:
38758888-38758888
AGintronicDe novo--Yuen2016 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More