or
or
Exact

Results for "CTBP2"

Variant Events: 557

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CTBP2     PN400498chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400498chr10:
126683099-126683099
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2339T
c.C719T
c.C719T
c.C719T
c.C719T
p.S780F
p.S240F
p.S240F
p.S240F
p.S240F
24.3-Leblond2019 E
CTBP2     PN400170chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400498chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400170chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400498chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400410chr10:
126683099-126683099
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2339T
c.C719T
c.C719T
c.C719T
c.C719T
p.S780F
p.S240F
p.S240F
p.S240F
p.S240F
24.3-Leblond2019 E
CTBP2     PN400410chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400410chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400323chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400323chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400323chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400410chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400260chr10:
126683099-126683099
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2339T
c.C719T
c.C719T
c.C719T
c.C719T
p.S780F
p.S240F
p.S240F
p.S240F
p.S240F
24.3-Leblond2019 E
CTBP2     PN400260chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400499chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400260chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400499chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400325chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400171chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
CTBP2     PN400551chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400171chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
CTBP2     PN400551chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400171chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400171chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400551chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400261chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400412chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400501chr10:
126686553-126686553
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2165T
c.C545T
c.C545T
c.C545T
c.C545T
p.T722M
p.T182M
p.T182M
p.T182M
p.T182M
27.21.705E-5Leblond2019 E
CTBP2     PN400501chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
CTBP2     PN400501chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
CTBP2     PN400412chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400326chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400554chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
CTBP2     PN400554chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
CTBP2     PN400178chr10:
126683099-126683099
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2339T
c.C719T
c.C719T
c.C719T
c.C719T
p.S780F
p.S240F
p.S240F
p.S240F
p.S240F
24.3-Leblond2019 E
CTBP2     PN400554chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400326chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400554chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400501chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400501chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400554chr10:
126692061-126692061
CCAAATTexonicUnknownframeshift insertionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1678_1679insAATTT
c.58_59insAATTT
c.58_59insAATTT
c.58_59insAATTT
c.58_59insAATTT
p.S560fs
p.G20fs
p.G20fs
p.G20fs
p.G20fs
--Leblond2019 E
CTBP2     PN400178chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400554chr10:
126692059-126692059
TTTCCTCexonicUnknownframeshift insertionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1680_1681insGAGGA
c.60_61insGAGGA
c.60_61insGAGGA
c.60_61insGAGGA
c.60_61insGAGGA
p.I561fs
p.I21fs
p.I21fs
p.I21fs
p.I21fs
--Leblond2019 E
CTBP2     PN400262chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400262chr10:
126683099-126683099
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2339T
c.C719T
c.C719T
c.C719T
c.C719T
p.S780F
p.S240F
p.S240F
p.S240F
p.S240F
24.3-Leblond2019 E
CTBP2     PN400262chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400415chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400415chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
CTBP2     PN400330chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400503chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400415chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400503chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400415chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
CTBP2     PN400556chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400556chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400330chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400179chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400416chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400416chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400179chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
CTBP2     PN400179chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400179chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
CTBP2     PN400264chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400504chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400264chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400504chr10:
126683099-126683099
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2339T
c.C719T
c.C719T
c.C719T
c.C719T
p.S780F
p.S240F
p.S240F
p.S240F
p.S240F
24.3-Leblond2019 E
CTBP2     1-0303-003chr10:
126890062-126890062
CTintergenicDe novo--Yuen2017 G
CTBP2     PN400264chr10:
126692061-126692061
CCAAATTexonicUnknownframeshift insertionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1678_1679insAATTT
c.58_59insAATTT
c.58_59insAATTT
c.58_59insAATTT
c.58_59insAATTT
p.S560fs
p.G20fs
p.G20fs
p.G20fs
p.G20fs
--Leblond2019 E
CTBP2     PN400264chr10:
126692059-126692059
TTTCCTCexonicUnknownframeshift insertionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1680_1681insGAGGA
c.60_61insGAGGA
c.60_61insGAGGA
c.60_61insGAGGA
c.60_61insGAGGA
p.I561fs
p.I21fs
p.I21fs
p.I21fs
p.I21fs
--Leblond2019 E
CTBP2     PN400504chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400264chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
CTBP2     PN400264chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
CTBP2     PN400557chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
CTBP2     PN400557chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400557chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
CTBP2     PN400332chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400417chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400505chr10:
126683099-126683099
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2339T
c.C719T
c.C719T
c.C719T
c.C719T
p.S780F
p.S240F
p.S240F
p.S240F
p.S240F
24.3-Leblond2019 E
CTBP2     PN400417chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     2-1297-003chr10:
126729427-126729427
CTintronicDe novo--Yuen2017 G
CTBP2     7-0254-004chr10:
127114733-127114733
CAintergenicDe novo--Yuen2017 G
CTBP2     PN400505chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     7-0254-004chr10:
127114737-127114737
GTintergenicDe novo--Yuen2017 G
CTBP2     PN400505chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400182chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
CTBP2     PN400417chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400182chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
CTBP2     PN400182chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400417chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
CTBP2     PN400182chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400417chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
CTBP2     PN400341chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400560chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400560chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400266chr10:
126683099-126683099
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2339T
c.C719T
c.C719T
c.C719T
c.C719T
p.S780F
p.S240F
p.S240F
p.S240F
p.S240F
24.3-Leblond2019 E
CTBP2     PN400266chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400341chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400266chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400560chr10:
126692061-126692061
CCAAATTexonicUnknownframeshift insertionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1678_1679insAATTT
c.58_59insAATTT
c.58_59insAATTT
c.58_59insAATTT
c.58_59insAATTT
p.S560fs
p.G20fs
p.G20fs
p.G20fs
p.G20fs
--Leblond2019 E
CTBP2     PN400560chr10:
126692059-126692059
TTTCCTCexonicUnknownframeshift insertionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1680_1681insGAGGA
c.60_61insGAGGA
c.60_61insGAGGA
c.60_61insGAGGA
c.60_61insGAGGA
p.I561fs
p.I21fs
p.I21fs
p.I21fs
p.I21fs
--Leblond2019 E
CTBP2     PN400186chr10:
126683099-126683099
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2339T
c.C719T
c.C719T
c.C719T
c.C719T
p.S780F
p.S240F
p.S240F
p.S240F
p.S240F
24.3-Leblond2019 E
CTBP2     AU3846303chr10:
126676065-126676065
TCdownstreamDe novo--Yuen2017 G
CTBP2     PN400100chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400100chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400186chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
CTBP2     PN400186chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
CTBP2     PN400186chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400186chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400343chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
CTBP2     PN400267chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400424chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400424chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400267chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400506chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400267chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400506chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400562chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400343chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400343chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
CTBP2     PN400343chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400102chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400190chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400102chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400507chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400507chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400431chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400564chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400564chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400272chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400272chr10:
126683099-126683099
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2339T
c.C719T
c.C719T
c.C719T
c.C719T
p.S780F
p.S240F
p.S240F
p.S240F
p.S240F
24.3-Leblond2019 E
CTBP2     PN400272chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400347chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
CTBP2     PN400347chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
CTBP2     PN400347chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400347chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400103chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400103chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     AU4056302chr10:
127249951-127249951
CGintergenicDe novo--Yuen2017 G
CTBP2     PN400508chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     3-0438-000chr10:
126977727-126977727
CAintergenicDe novo--Yuen2016 G
CTBP2     PN400508chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400273chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
CTBP2     PN400565chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400273chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
CTBP2     PN400565chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400434chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400434chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400104chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400104chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     2-1107-003chr10:
127110084-127110097
CTGTGTGTGTGTGTCTGTGTGTGTGTintergenicDe novo--Yuen2017 G
CTBP2     PN400104chr10:
126692050-126692050
GAexonicUnknownstopgainNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C1690T
c.C70T
c.C70T
c.C70T
c.C70T
p.Q564X
p.Q24X
p.Q24X
p.Q24X
p.Q24X
38.0-Leblond2019 E
CTBP2     PN400273chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400273chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400565chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400195chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400348chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400348chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400439chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400439chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400439chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400277chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400277chr10:
126683099-126683099
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2339T
c.C719T
c.C719T
c.C719T
c.C719T
p.S780F
p.S240F
p.S240F
p.S240F
p.S240F
24.3-Leblond2019 E
CTBP2     PN400512chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400568chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400568chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400512chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400108chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400108chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
CTBP2     AU076508chr10:
126681770-126681770
CTsplicingDe novosplicing22.1-Yuen2017 G
CTBP2     PN400108chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
CTBP2     PN400349chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400349chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400349chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400575chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400514chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400575chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400203chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400441chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400203chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400279chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400514chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
CTBP2     PN400514chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
CTBP2     PN400514chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400514chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     1-0777-003chr10:
126963764-126963764
AGintergenicDe novo--Yuen2017 G
CTBP2     PN400111chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400350chr10:
126683225-126683225
CGexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2213C
c.G593C
c.G593C
c.G593C
c.G593C
p.R738P
p.R198P
p.R198P
p.R198P
p.R198P
34.0-Leblond2019 E
CTBP2     PN400350chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400111chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400111chr10:
126683099-126683099
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2339T
c.C719T
c.C719T
c.C719T
c.C719T
p.S780F
p.S240F
p.S240F
p.S240F
p.S240F
24.3-Leblond2019 E
CTBP2     PN400443chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     2-1480-003chr10:
126887450-126887450
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
CTBP2     PN400443chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
CTBP2     PN400443chr10:
126683225-126683225
CGexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2213C
c.G593C
c.G593C
c.G593C
c.G593C
p.R738P
p.R198P
p.R198P
p.R198P
p.R198P
34.0-Leblond2019 E
CTBP2     PN400350chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400350chr10:
126683235-126683235
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2203T
c.G583T
c.G583T
c.G583T
c.G583T
p.V735F
p.V195F
p.V195F
p.V195F
p.V195F
25.5-Leblond2019 E
CTBP2     PN400576chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400205chr10:
126683099-126683099
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2339T
c.C719T
c.C719T
c.C719T
c.C719T
p.S780F
p.S240F
p.S240F
p.S240F
p.S240F
24.3-Leblond2019 E
CTBP2     PN400576chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400576chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400443chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400443chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
CTBP2     A6chr10:
126932420-126932420
ACintergenicDe novo--Wu2018 G
CTBP2     PN400443chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400515chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
CTBP2     PN400515chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400515chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400515chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
CTBP2     PN400205chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400280chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400205chr10:
126683190-126683190
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2248T
c.G628T
c.G628T
c.G628T
c.G628T
p.D750Y
p.D210Y
p.D210Y
p.D210Y
p.D210Y
28.2-Leblond2019 E
CTBP2     PN400280chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2     PN400576chr10:
126692050-126692050
GAexonicUnknownstopgainNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C1690T
c.C70T
c.C70T
c.C70T
c.C70T
p.Q564X
p.Q24X
p.Q24X
p.Q24X
p.Q24X
38.0-Leblond2019 E
CTBP2     PN400205chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400352chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
CTBP2     PN400352chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
CTBP2     PN400515chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400113chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400113chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
CTBP2