Variant Results

or

or

Results for "KIAA0319"

Variant Events: 7

Gene Gene symbol on which the variant is located	ID Subject Identifier from the original study	Location Genomic location of the reference allele	REF Reference allele	ALT Alternate allele	Context Variant functional categories	Variant validation performed by an orthogonal method and reported	Inheritance Reported inheritance status	Effects Variant effect on transcript per Annovar	Transcript Transcript used for the cDNA/Protein mutation	cDNA cDNA variant notation	Protein Protein variant notation	CADD-Phred v1.0 CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores	ExAC v0.3 ExAC population frequency (version 0.3)	Sources Source(s) where variants from this event are reported
KIAA0319	AU4284301	chr6: 24593119-24593119	G	T	intronic		De novo					-	-	Yuen2017 G
KIAA0319	Lim2017:6301	chr6: 24564464-24564464	C	T	exonic		De novo	synonymous SNV	NM_001252328 NM_001168376 NM_001168375 NM_001168377 NM_014809 NM_001168374	c.G630A c.G2262A c.G2397A c.G2397A c.G2397A c.G2370A	p.S210S p.S754S p.S799S p.S799S p.S799S p.S790S	-	1.65E-5	Lim2017 E
KIAA0319	AU2333302	chr6: 24593413-24593413	C	T	intronic		De novo					-	-	Yuen2017 G
KIAA0319	2-0305-003	chr6: 24557576-24557576	A	G	intronic		De novo					-	-	Yuen2017 G
KIAA0319	1-0153-004	chr6: 24565081-24565081	G	A	intronic		De novo					-	-	Yuen2017 G
KIAA0319	AU4093304	chr6: 24544219-24544239	TGTAAAAGGCCAGATAGTAAA	TGTAAA	downstream		De novo					-	-	Yuen2017 G
KIAA0319	12621.p1	chr6: 24564464-24564464	C	T	exonic		De novo	synonymous SNV	NM_001252328 NM_001168376 NM_001168375 NM_001168377 NM_014809 NM_001168374	c.G630A c.G2262A c.G2397A c.G2397A c.G2397A c.G2370A	p.S210S p.S754S p.S799S p.S799S p.S799S p.S790S	-	1.65E-5	Iossifov2014 E Kosmicki2017 E O’Roak2012b E Satterstrom2020 E Wilfert2021 G

Source Variant Information

, -

Source:

Paper alias:

No records found.

Paper Information

Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count	The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notes	View
	More