or
or
Exact

Results for "MYO7B"

Variant Events: 21

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MYO7B     1-0336-004chr2:
128341916-128341916
TAintronicDe novo--Yuen2017 G
MYO7B     03HI2710Achr2:
128390811-128390811
CTintronicDe novo--Satterstrom2020 E
MYO7B     14283.p1chr2:
128366324-128366324
CTexonicDe novosynonymous SNVNM_001080527c.C2685Tp.G895G-5.148E-5Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
MYO7B     iHART3115chr2:
128394890-128394890
GAsplicingMaternalsplicing16.294.0E-4Ruzzo2019 G
MYO7B     12933.p1chr2:
128381815-128381815
CTexonicDe novononsynonymous SNVNM_001080527c.C3889Tp.R1297W14.423.892E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012b E
Satterstrom2020 E
MYO7B     iHART3114chr2:
128394890-128394890
GAsplicingMaternalsplicing16.294.0E-4Ruzzo2019 G
MYO7B     13598.p1chr2:
128384626-128384626
CTexonicDe novononsynonymous SNVNM_001080527c.C4214Tp.P1405L32.02.074E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
MYO7B     12906.p1chr2:
128388847-128388847
GCexonicDe novononsynonymous SNVNM_001080527c.G4926Cp.W1642C17.73-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
MYO7B     1-0568-003chr2:
128393266-128393266
AACCCAGCATGintronicDe novo-0.001Yuen2017 G
MYO7B     iHART2434chr2:
128389939-128389940
GCGexonicMaternalframeshift deletionNM_001080527c.5291delCp.A1764fs-9.293E-6Ruzzo2019 G
MYO7B     iHART2730chr2:
128338397-128338397
GGCTexonicMaternalframeshift insertionNM_001080527c.1080_1081insCTp.E360fs-8.281E-5Ruzzo2019 G
MYO7B     Lim2017:36081chr2:
128366324-128366324
CTexonicDe novosynonymous SNVNM_001080527c.C2685Tp.G895G-5.148E-5Lim2017 E
MYO7B     11134.p1chr2:
128363533-128363533
GAintronicDe novo--Krumm2015 E
Satterstrom2020 E
MYO7B     2-1342-003chr2:
128293614-128293630
TGAGGAGGAGGAGGAGGTGAGGAGGAGGAGGintronicDe novo--Yuen2017 G
MYO7B     104-06-105816chr2:
128345990-128345990
GAexonicDe novononsynonymous SNVNM_001080527c.G1714Ap.V572M4.8753.0E-4Satterstrom2020 E
MYO7B     2H596chr2:
128384714-128384714
CTintronicDe novo--Satterstrom2020 E
MYO7B     Lim2017:78714chr2:
128384626-128384626
CTexonicDe novononsynonymous SNVNM_001080527c.C4214Tp.P1405L32.02.074E-5Lim2017 E
MYO7B     AU002903chr2:
128382450-128382450
CTintronicDe novo--Yuen2017 G
MYO7B     AU3809302chr2:
128378624-128378624
CGintronicDe novo--Yuen2017 G
MYO7B     Lim2017:4899chr2:
128381815-128381815
CTexonicDe novononsynonymous SNVNM_001080527c.C3889Tp.R1297W14.423.892E-5Lim2017 E
MYO7B     2-0142-004chr2:
128394339-128394339
GAintronicDe novo-9.215E-5Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More