or
or
Exact

Results for "STK36"

Variant Events: 7

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
STK36     SSC10287chr2:
219562284-219562284
AGexonicDe novononsynonymous SNVNM_001243313
NM_015690
c.A2797G
c.A2860G
p.I933V
p.I954V
7.615-Lim2017 E
STK36     12335.p1chr2:
219537583-219537583
GAexonicDe novononsynonymous SNVNM_001243313
NM_015690
c.G31A
c.G31A
p.G11R
p.G11R
36.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
O’Roak2012b E
Satterstrom2020 E
Wilfert2021 G
STK36     13902.p1chr2:
219562284-219562284
AGexonicDe novononsynonymous SNVNM_001243313
NM_015690
c.A2797G
c.A2860G
p.I933V
p.I954V
7.615-Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
STK36     iHART1991chr2:
219563323-219563323
AGsplicingPaternalsplicing14.72-Ruzzo2019 G
STK36     iHART1581chr2:
219561937-219561937
GTsplicingPaternalsplicing17.03-Ruzzo2019 G
STK36     1-0606-003chr2:
219547310-219547336
CTTTATTTATTTATTTATTTATTTATTCTTTATTTATTTATTTATTTATTintronicDe novo--Yuen2017 G
STK36     AU2333302chr2:
219546500-219546500
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More