or
or
Exact

Results for "CACNA1G"

Variant Events: 14

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CACNA1G     13069.p1chr17:
48657385-48657385
GTintronicDe novo--Turner2016 G
CACNA1G     Viggiano2022:48.3chr17:
48646652-48646652
ATexonicPaternalnonsynonymous SNVNM_001256324
NM_001256325
NM_001256326
NM_001256327
NM_001256328
NM_001256329
NM_001256330
NM_001256331
NM_001256332
NM_001256333
NM_001256334
NM_001256359
NM_001256360
NM_001256361
NM_018896
NM_198376
NM_198377
NM_198378
NM_198379
NM_198380
NM_198382
NM_198383
NM_198384
NM_198385
NM_198386
NM_198387
NM_198388
NM_198396
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
c.A481T
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
p.I161F
13.892.485E-5Viggiano2022 GT
CACNA1G     13462.p1chr17:
48647139-48647139
GAexonicDe novosynonymous SNVNM_001256324
NM_001256325
NM_001256326
NM_001256327
NM_001256328
NM_001256329
NM_001256330
NM_001256331
NM_001256332
NM_001256333
NM_001256334
NM_001256359
NM_001256360
NM_001256361
NM_018896
NM_198376
NM_198377
NM_198378
NM_198379
NM_198380
NM_198382
NM_198383
NM_198384
NM_198385
NM_198386
NM_198387
NM_198388
NM_198396
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
--Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
CACNA1G     11573.p1chr17:
48680533-48680533
GAexonicDe novononsynonymous SNVNM_001256332
NM_198376
NM_198379
NM_198382
NM_198383
NM_198387
NM_198388
NM_198396
NM_001256324
NM_001256325
NM_001256326
NM_001256327
NM_001256328
NM_001256329
NM_001256330
NM_001256331
NM_001256333
NM_001256334
NM_001256359
NM_001256360
NM_001256361
NM_018896
NM_198377
NM_198378
NM_198380
NM_198384
NM_198385
NM_198386
c.G4073A
c.G4073A
c.G4073A
c.G4073A
c.G4073A
c.G4073A
c.G4073A
c.G4073A
c.G4142A
c.G4142A
c.G4142A
c.G4142A
c.G4142A
c.G4142A
c.G4142A
c.G4142A
c.G4142A
c.G4142A
c.G4142A
c.G4142A
c.G4142A
c.G4142A
c.G4142A
c.G4142A
c.G4142A
c.G4142A
c.G4142A
c.G4142A
p.R1358Q
p.R1358Q
p.R1358Q
p.R1358Q
p.R1358Q
p.R1358Q
p.R1358Q
p.R1358Q
p.R1381Q
p.R1381Q
p.R1381Q
p.R1381Q
p.R1381Q
p.R1381Q
p.R1381Q
p.R1381Q
p.R1381Q
p.R1381Q
p.R1381Q
p.R1381Q
p.R1381Q
p.R1381Q
p.R1381Q
p.R1381Q
p.R1381Q
p.R1381Q
p.R1381Q
p.R1381Q
35.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Turner2017 G
Wilfert2021 G
CACNA1G     10C113676chr17:
48695619-48695619
GAexonicDe novononsynonymous SNVNM_198376
NM_198379
NM_198387
NM_198388
NM_198396
NM_001256324
NM_001256326
NM_001256328
NM_001256330
NM_001256331
NM_001256332
NM_001256334
NM_001256360
NM_001256361
NM_198377
NM_198378
NM_198380
NM_198382
NM_198383
NM_198386
NM_001256325
NM_001256327
NM_001256329
NM_001256333
NM_001256359
NM_018896
NM_198384
NM_198385
c.G5240A
c.G5240A
c.G5240A
c.G5219A
c.G5240A
c.G5288A
c.G5207A
c.G5267A
c.G5207A
c.G5186A
c.G5171A
c.G5309A
c.G5234A
c.G5228A
c.G5309A
c.G5309A
c.G5309A
c.G5273A
c.G5273A
c.G5288A
c.G5363A
c.G5321A
c.G5240A
c.G5342A
c.G5261A
c.G5342A
c.G5342A
c.G5342A
p.R1747H
p.R1747H
p.R1747H
p.R1740H
p.R1747H
p.R1763H
p.R1736H
p.R1756H
p.R1736H
p.R1729H
p.R1724H
p.R1770H
p.R1745H
p.R1743H
p.R1770H
p.R1770H
p.R1770H
p.R1758H
p.R1758H
p.R1763H
p.R1788H
p.R1774H
p.R1747H
p.R1781H
p.R1754H
p.R1781H
p.R1781H
p.R1781H
32.02.486E-5Satterstrom2020 E
CACNA1G     AU1698302chr17:
48644370-48644370
ACintronicDe novo--Yuen2017 G
CACNA1G     Viggiano2022:66.3chr17:
48674196-48674196
GAexonicMaternalnonsynonymous SNVNM_001256332
NM_198376
NM_198379
NM_198382
NM_198383
NM_198387
NM_198388
NM_198396
NM_001256324
NM_001256325
NM_001256326
NM_001256327
NM_001256328
NM_001256329
NM_001256330
NM_001256331
NM_001256333
NM_001256334
NM_001256359
NM_001256360
NM_001256361
NM_018896
NM_198377
NM_198378
NM_198380
NM_198384
NM_198385
NM_198386
c.G3101A
c.G3101A
c.G3101A
c.G3101A
c.G3101A
c.G3101A
c.G3101A
c.G3101A
c.G3170A
c.G3170A
c.G3170A
c.G3170A
c.G3170A
c.G3170A
c.G3170A
c.G3170A
c.G3170A
c.G3170A
c.G3170A
c.G3170A
c.G3170A
c.G3170A
c.G3170A
c.G3170A
c.G3170A
c.G3170A
c.G3170A
c.G3170A
p.G1034D
p.G1034D
p.G1034D
p.G1034D
p.G1034D
p.G1034D
p.G1034D
p.G1034D
p.G1057D
p.G1057D
p.G1057D
p.G1057D
p.G1057D
p.G1057D
p.G1057D
p.G1057D
p.G1057D
p.G1057D
p.G1057D
p.G1057D
p.G1057D
p.G1057D
p.G1057D
p.G1057D
p.G1057D
p.G1057D
p.G1057D
p.G1057D
20.9-Viggiano2022 GT
CACNA1G     Viggiano2022:34.3chr17:
48653223-48653223
GAexonicMaternalnonsynonymous SNVNM_001256324
NM_001256325
NM_001256326
NM_001256327
NM_001256328
NM_001256329
NM_001256330
NM_001256331
NM_001256332
NM_001256333
NM_001256334
NM_001256359
NM_001256360
NM_001256361
NM_018896
NM_198376
NM_198377
NM_198378
NM_198379
NM_198380
NM_198382
NM_198383
NM_198384
NM_198385
NM_198386
NM_198387
NM_198388
NM_198396
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
c.G1460A
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
p.R487H
18.385.387E-5Viggiano2022 GT
CACNA1G     Viggiano2022:5.3chr17:
48703465-48703465
CGexonicPaternalnonsynonymous SNVNM_198387
NM_198388
NM_001256328
NM_001256330
NM_001256331
NM_001256332
NM_001256360
NM_001256361
NM_198378
NM_198379
NM_198382
NM_198386
NM_001256324
NM_001256325
NM_001256326
NM_001256327
NM_001256329
NM_001256359
NM_198380
NM_198383
NM_198384
NM_198396
NM_198377
NM_198385
NM_018896
c.C6106G
c.C6085G
c.C6133G
c.C6073G
c.C6052G
c.C6037G
c.C6100G
c.C6094G
c.C6175G
c.C6250G
c.C6139G
c.C6154G
c.C6298G
c.C6229G
c.C6217G
c.C6187G
c.C6106G
c.C6127G
c.C6319G
c.C6274G
c.C6208G
c.C6385G
c.C6454G
c.C6352G
c.C6487G
p.L2036V
p.L2029V
p.L2045V
p.L2025V
p.L2018V
p.L2013V
p.L2034V
p.L2032V
p.L2059V
p.L2084V
p.L2047V
p.L2052V
p.L2100V
p.L2077V
p.L2073V
p.L2063V
p.L2036V
p.L2043V
p.L2107V
p.L2092V
p.L2070V
p.L2129V
p.L2152V
p.L2118V
p.L2163V
6.403-Viggiano2022 GT
CACNA1G     518-09-112528chr17:
48677099-48677099
GTexonicDe novononsynonymous SNVNM_001256332
NM_198376
NM_198379
NM_198382
NM_198383
NM_198387
NM_198388
NM_198396
NM_001256324
NM_001256325
NM_001256326
NM_001256327
NM_001256328
NM_001256329
NM_001256330
NM_001256331
NM_001256333
NM_001256334
NM_001256359
NM_001256360
NM_001256361
NM_018896
NM_198377
NM_198378
NM_198380
NM_198384
NM_198385
NM_198386
c.G3500T
c.G3500T
c.G3500T
c.G3500T
c.G3500T
c.G3500T
c.G3500T
c.G3500T
c.G3569T
c.G3569T
c.G3569T
c.G3569T
c.G3569T
c.G3569T
c.G3569T
c.G3569T
c.G3569T
c.G3569T
c.G3569T
c.G3569T
c.G3569T
c.G3569T
c.G3569T
c.G3569T
c.G3569T
c.G3569T
c.G3569T
c.G3569T
p.R1167L
p.R1167L
p.R1167L
p.R1167L
p.R1167L
p.R1167L
p.R1167L
p.R1167L
p.R1190L
p.R1190L
p.R1190L
p.R1190L
p.R1190L
p.R1190L
p.R1190L
p.R1190L
p.R1190L
p.R1190L
p.R1190L
p.R1190L
p.R1190L
p.R1190L
p.R1190L
p.R1190L
p.R1190L
p.R1190L
p.R1190L
p.R1190L
9.153-Satterstrom2020 E
CACNA1G     PN400503chr17:
48650405-48650407
CGACexonicUnknownframeshift deletionNM_001256324
NM_001256325
NM_001256326
NM_001256327
NM_001256328
NM_001256329
NM_001256330
NM_001256331
NM_001256332
NM_001256333
NM_001256334
NM_001256359
NM_001256360
NM_001256361
NM_018896
NM_198376
NM_198377
NM_198378
NM_198379
NM_198380
NM_198382
NM_198383
NM_198384
NM_198385
NM_198386
NM_198387
NM_198388
NM_198396
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
c.1072_1073del
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
p.D358fs
--Leblond2019 E
CACNA1G     AU4310301chr17:
48706398-48706398
TCintergenicDe novo--Yuen2017 G
CACNA1G     2-1206-003chr17:
48654851-48654864
AGTGTGTGTGTGTGAGTGTGTGTGTGintronicDe novo--Yuen2017 G
CACNA1G     SSC07472chr17:
48647139-48647139
GAexonicDe novosynonymous SNVNM_001256324
NM_001256325
NM_001256326
NM_001256327
NM_001256328
NM_001256329
NM_001256330
NM_001256331
NM_001256332
NM_001256333
NM_001256334
NM_001256359
NM_001256360
NM_001256361
NM_018896
NM_198376
NM_198377
NM_198378
NM_198379
NM_198380
NM_198382
NM_198383
NM_198384
NM_198385
NM_198386
NM_198387
NM_198388
NM_198396
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
c.G561A
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
p.P187P
--Lim2017 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More