or
or
Exact

Results for "PRKAG2"

Variant Events: 22

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PRKAG2     2-1186-003chr7:
151527303-151527303
TCintronicDe novo--Yuen2017 G
PRKAG2     2-1345-003chr7:
151472301-151472301
GAintronicDe novo--Yuen2017 G
PRKAG2     1-0253-004chr7:
151300259-151300291
ACGGAGGGACACGCTCCGTCCTCACCGCACACGAintronicDe novo--Yuen2017 G
PRKAG2     AU076704chr7:
151443603-151443603
ACintronicDe novo--Yuen2017 G
PRKAG2     1-0092-003chr7:
151518147-151518147
GGAGCCTCCAintronicDe novo--Yuen2017 G
PRKAG2     1-0651-003chr7:
151537622-151537622
CTintronicDe novo--Yuen2017 G
PRKAG2     A41chr7:
151372597-151372597
GAexonicDe novononsynonymous SNVNM_001304527
NM_001040633
NM_016203
c.C221T
c.C461T
c.C593T
p.P74L
p.P154L
p.P198L
15.688.264E-6Jiao2019 E
PRKAG2     AU2089301chr7:
151494002-151494002
GAintronicDe novo--Yuen2017 G
PRKAG2     2-0006-004chr7:
151366854-151366854
GGCAintronicDe novo--Yuen2017 G
PRKAG2     1-0971-003chr7:
151311792-151311792
CGintronicDe novo--Yuen2017 G
PRKAG2     2-0214-003chr7:
151548225-151548225
AGintronicDe novo--Yuen2017 G
PRKAG2     F10209-1chr7:
151372572-151372572
CTexonicDe novosynonymous SNVNM_001304527
NM_001040633
NM_016203
c.G246A
c.G486A
c.G618A
p.P82P
p.P162P
p.P206P
-1.652E-5Fu2022 E
PRKAG2     2-1359-004chr7:
151366864-151366864
TCintronicDe novo--Yuen2017 G
PRKAG2     AU065304chr7:
151308768-151308768
TCintronicDe novo--Yuen2017 G
PRKAG2     1-0677-003chr7:
151270167-151270167
CTintronicDe novo--Yuen2017 G
PRKAG2     2-1290-004chr7:
151272216-151272216
TCintronicDe novo--Yuen2017 G
PRKAG2     7-0179-003chr7:
151538958-151538975
GGTAGTGATAGTAGTGATGGTAGTGATintronicDe novo--Yuen2017 G
PRKAG2     2-1134-003chr7:
151568327-151568327
GAintronicDe novo--Yuen2017 G
PRKAG2     2-1140-003chr7:
151305968-151305968
TCintronicDe novo--Yuen2017 G
PRKAG2     AU3175302chr7:
151406823-151406828
AGTGTGAGTGintronicDe novo--Yuen2017 G
PRKAG2     1-0497-003chr7:
151566584-151566584
CTintronicDe novo--Yuen2017 G
PRKAG2     2-1736-003chr7:
151518509-151518509
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More