or
or
Exact

Results for "EML1"

Variant Events: 35

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
EML1     1-0408-003chr14:
100314475-100314475
TAintronicDe novo--Yuen2016 G
EML1     AU3858303chr14:
100414306-100414306
AGintergenicDe novo--Yuen2017 G
EML1     5-0125-003chr14:
100421967-100421967
AGintergenicDe novo--Yuen2017 G
EML1     1-0324-003chr14:
100269679-100269679
AGintronicDe novo--Trost2022 G
Yuen2017 G
EML1     AU3175303chr14:
100395075-100395075
GAintronicDe novo--Trost2022 G
Yuen2017 G
EML1     Schaaf2011:23chr14:
100375794-100375794
AGexonicUnknownnonsynonymous SNVNM_004434
NM_001008707
c.A1217G
c.A1274G
p.N406S
p.N425S
4.2173.295E-5Schaaf2011 T
EML1     AU4186302chr14:
100411677-100411677
GAintergenicDe novo--Yuen2017 G
EML1     2-1426-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
EML1     5-0022-003chr14:
100303179-100303179
GAintronicDe novo--Trost2022 G
EML1     3-0476-000chr14:
100310078-100310078
TCintronicDe novo--Trost2022 G
EML1     Schaaf2011:24chr14:
100380564-100380564
GAexonicUnknownnonsynonymous SNVNM_004434
NM_001008707
c.G1543A
c.G1600A
p.D515N
p.D534N
15.323.0E-4Schaaf2011 T
EML1     2-0135-003chr14:
100277496-100277498
AATTACintronicDe novo--Trost2022 G
EML1     REACH000747chr14:
100289308-100289308
CGintronicDe novo--Trost2022 G
EML1     2-0135-003chr14:
100277481-100277482
TAGATCCACCCACGTCGGCCTCCCintronicDe novo--Trost2022 G
EML1     2-0135-003chr14:
100277490-100277493
ATGTTGGGintronicDe novo--Trost2022 G
EML1     1-0217-003chr14:
100274450-100274450
CTintronicDe novo--Trost2022 G
EML1     MT_151.4chr14:
100394363-100394363
GAintronicDe novo--Trost2022 G
EML1     MSSNG00354-003chr14:
100396310-100396310
GCintronicDe novo--Trost2022 G
EML1     2-1467-003chr14:
100362346-100362346
GGAintronicDe novo--Trost2022 G
EML1     7-0329-003chr14:
100389960-100389960
CAintronicDe novo--Trost2022 G
EML1     MT_21.3chr14:
100341081-100341081
GAintronicDe novo--Trost2022 G
EML1     MT_16.3chr14:
100362254-100362255
TCTintronicDe novo--Trost2022 G
EML1     AU2137304chr14:
100399595-100399595
CTintronicDe novo--Yuen2017 G
EML1     MSSNG00081-003chr14:
100325745-100325745
GAintronicDe novo--Trost2022 G
EML1     MSSNG00256-003chr14:
100329544-100329544
ACintronicDe novo--Trost2022 G
EML1     MSSNG00340-004chr14:
100503446-100503446
CTintergenicDe novo--Trost2022 G
EML1     REACH000727chr14:
100486950-100486950
AGintergenicDe novo--Trost2022 G
EML1     1-0142-005chr14:
100501919-100501920
CCATintergenicDe novo--Trost2022 G
EML1     MSSNG00032-003chr14:
100401372-100401372
ACintronicDe novo--Trost2022 G
EML1     REACH000327chr14:
100437466-100437466
GAintergenicDe novo--Trost2022 G
EML1     SJD_79.3chr14:
100406369-100406369
GAexonicDe novononsynonymous SNVNM_004434
NM_001008707
c.G2368A
c.G2425A
p.V790I
p.V809I
33.0-Trost2022 G
Zhou2022 GE
EML1     SP0024380chr14:
100367284-100367284
CTexonicnonsynonymous SNVNM_004434
NM_001008707
c.C916T
c.C973T
p.R306C
p.R325C
23.88.239E-6Zhou2022 GE
EML1     7-0247-003chr14:
100327630-100327630
CTintronicDe novo--Trost2022 G
Yuen2017 G
EML1     AU000704chr14:
100313605-100313605
AGintronicDe novo--Yuen2017 G
EML1     AU3955303chr14:
100467209-100467209
AGintergenicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More