or
or
Exact

Results for "FBXO11"

Variant Events: 35

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FBXO11     1-0261-004chr2:
48095136-48095136
GAintronicDe novo--Yuen2017 G
FBXO11     1-0261-004chr2:
48093847-48093847
GAintronicDe novo--Yuen2017 G
FBXO11     1-0756-004chr2:
48065523-48065523
TTAintronicDe novo--Yuen2017 G
FBXO11     3-0111-000chr2:
48351387-48351387
CTintergenicDe novo--Yuen2016 G
FBXO11     1-0246-004chr2:
48523996-48523996
CTintergenicDe novo--Yuen2017 G
FBXO11     2-1244-003chr2:
48483853-48483853
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
FBXO11     2-0144-003chr2:
48451610-48451610
GCintergenicDe novo--Yuen2017 G
FBXO11     2-0306-004chr2:
48370339-48370339
GCintergenicDe novo--Yuen2017 G
FBXO11     A51chr2:
48037458-48037458
CTexonicDe novononsynonymous SNVNM_001190274
NM_025133
c.G2335A
c.G2083A
p.A779T
p.A695T
35.0-Jiao2019 E
FBXO11     2-1220-003chr2:
48179146-48179146
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
FBXO11     1-0010-005chr2:
48376078-48376078
CTintergenicDe novo--Yuen2017 G
FBXO11     1-0285-003chr2:
48516186-48516186
GAintergenicDe novo--Yuen2017 G
FBXO11     2-1086-004chr2:
48289084-48289085
GTGintergenicDe novo--Yuen2017 G
FBXO11     AU078503chr2:
48242062-48242062
TCintergenicDe novo--Yuen2017 G
FBXO11     A25chr2:
48468141-48468141
TCintergenicDe novo--Wu2018 G
FBXO11     1-0045-004chr2:
48181510-48181510
GGCACTCintergenicDe novo--Yuen2017 G
FBXO11     2-1486-003chr2:
48128136-48128138
CGGCGintronicDe novo--Yuen2017 G
FBXO11     AU2433302chr2:
48318909-48318909
CAintergenicDe novo--Yuen2017 G
FBXO11     SSC02723chr2:
48040938-48040938
TAexonicDe novononsynonymous SNVNM_001190274
NM_025133
c.A2075T
c.A1823T
p.Y692F
p.Y608F
25.2-Lim2017 E
FBXO11     2-1736-003chr2:
48268528-48268528
GCintergenicDe novo--Yuen2017 G
FBXO11     1-0547-003chr2:
48166342-48166342
CGintergenicDe novo--Yuen2017 G
FBXO11     AU3716301chr2:
48403130-48403130
CGintergenicDe novo--Yuen2017 G
FBXO11     2-1370-003chr2:
48501243-48501243
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
FBXO11     2-1438-003chr2:
48135683-48135683
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
FBXO11     2-0319-003chr2:
48052920-48052920
CTintronicDe novo--Yuen2017 G
FBXO11     1-0559-004chr2:
48416274-48416274
TGintergenicDe novo--Yuen2017 G
FBXO11     7-0102-003chr2:
48049533-48049533
ATintronicDe novo--Yuen2017 G
FBXO11     AU3918301chr2:
48144514-48144514
GAintergenicDe novo--Yuen2017 G
FBXO11     13810.p1chr2:
48035295-48035297
CAGCexonicDe novoframeshift deletionNM_001190274
NM_025133
c.2744_2745del
c.2492_2493del
p.S915fs
p.S831fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
FBXO11     11483.p1chr2:
48040938-48040938
TAexonicDe novononsynonymous SNVNM_001190274
NM_025133
c.A2075T
c.A1823T
p.Y692F
p.Y608F
25.2-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
FBXO11     2-1427-003chr2:
48492820-48492820
GAintergenicDe novo--Yuen2017 G
FBXO11     1-0259-003chr2:
48041690-48041690
GTintronicDe novo--Yuen2017 G
FBXO11     AU4013303chr2:
48404831-48404831
GAintergenicDe novo--Yuen2017 G
FBXO11     2-1737-003chr2:
48150242-48150248
AAAGAGAAAintergenicDe novo--Yuen2017 G
FBXO11     1-0389-004chr2:
48530696-48530696
CCTGGAGTGCAGTGTCGCAAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More