or
or
Exact

Results for "ADGRL4"

Variant Events: 95

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ADGRL4     13609.p1chr1:
80384890-80384890
GCintergenicDe novo--Werling2018 G
ADGRL4     1-0075-003chr1:
80133102-80133102
GAintergenicDe novo--Yuen2017 G
ADGRL4     1-0173-004chr1:
80215470-80215470
CAintergenicDe novo--Yuen2017 G
ADGRL4     AU2293302chr1:
80983544-80983544
GAintergenicDe novo--Yuen2017 G
ADGRL4     AU4273304chr1:
79869237-79869237
AGintergenicDe novo--Yuen2017 G
ADGRL4     7-0058-003chr1:
79650274-79650274
AAAACintergenicDe novo--Yuen2017 G
ADGRL4     AU3760302chr1:
79411969-79411969
GAexonicDe novosynonymous SNVNM_022159c.C315Tp.T105T--Yuen2017 G
ADGRL4     AU071204chr1:
80101485-80101485
TCintergenicDe novo--Yuen2017 G
ADGRL4     1-0571-003chr1:
80791089-80791089
GAintergenicDe novo--Yuen2017 G
ADGRL4     1-0285-004chr1:
80927536-80927536
GAintergenicDe novo--Yuen2017 G
ADGRL4     1-0382-003chr1:
79656844-79656844
CTintergenicDe novo--Yuen2017 G
ADGRL4     5-0084-003chr1:
80271177-80271177
CTintergenicDe novo--Yuen2017 G
ADGRL4     2-1736-003chr1:
79905445-79905445
TCintergenicDe novo--Yuen2017 G
ADGRL4     AU4032307chr1:
80838288-80838288
AGintergenicDe novo--Yuen2017 G
ADGRL4     1-0636-003chr1:
80214653-80214667
CGTGTGTGTGTGTGTCGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
ADGRL4     AU056604chr1:
79978298-79978298
ACintergenicDe novo--Yuen2017 G
ADGRL4     1-0570-003chr1:
79426977-79426977
GAintronicDe novo--Yuen2017 G
ADGRL4     2-0043-003chr1:
80765488-80765488
GAintergenicDe novo--Yuen2016 G
ADGRL4     2-1477-003chr1:
80271725-80271725
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
ADGRL4     2-0003-003chr1:
79473990-79473990
CAintergenicDe novo--Yuen2017 G
ADGRL4     1-0652-004chr1:
80293282-80293282
AATintergenicDe novo--Yuen2017 G
ADGRL4     2-1562-004chr1:
80340818-80340818
AAACTintergenicDe novo--Yuen2017 G
ADGRL4     5-0105-003chr1:
80741805-80741805
AGintergenicDe novo--Yuen2017 G
ADGRL4     5-0061-003chr1:
80853290-80853290
CAintergenicDe novo--Yuen2017 G
ADGRL4     1-0443-003chr1:
79409345-79409345
CTintronicDe novo--Yuen2016 G
ADGRL4     1-0303-004chr1:
80551102-80551102
TAintergenicDe novo--Yuen2017 G
ADGRL4     2-1508-004chr1:
79669423-79669423
GCintergenicDe novo--Yuen2017 G
ADGRL4     1-0606-003chr1:
79695109-79695124
CTATTATTATTATTATCTATTATTATTATintergenicDe novo--Yuen2017 G
ADGRL4     2-1620-003chr1:
80962679-80962679
TTATCintergenicDe novo--Yuen2017 G
ADGRL4     AU3371302chr1:
79477138-79477138
CTintergenicDe novo--Yuen2017 G
ADGRL4     14370.p1chr1:
79386595-79386595
CTintronicDe novo--Turner2016 G
ADGRL4     1-0073-003chr1:
79815288-79815288
AGintergenicDe novo--Yuen2017 G
ADGRL4     14496.p1chr1:
79620003-79620003
TAintergenicDe novo--Turner2016 G
ADGRL4     AU079104chr1:
80841796-80841796
CGintergenicDe novo--Yuen2017 G
ADGRL4     1-0197-004chr1:
80898399-80898399
CAintergenicDe novo--Yuen2017 G
ADGRL4     2-0063-003chr1:
80909843-80909843
GAintergenicDe novo--Yuen2017 G
ADGRL4     AU4284301chr1:
80499736-80499736
GCintergenicDe novo--Yuen2017 G
ADGRL4     AU0039303chr1:
80026670-80026670
TCintergenicDe novo--Yuen2017 G
ADGRL4     14153.p1chr1:
80326263-80326263
GAintergenicDe novo--Turner2016 G
ADGRL4     11456.p1chr1:
80454899-80454899
TCintergenicDe novo--Turner2016 G
ADGRL4     AU3858302chr1:
80384650-80384650
GAintergenicDe novo--Yuen2017 G
ADGRL4     1-0455-003chr1:
79640082-79640082
GAintergenicDe novo--Yuen2017 G
ADGRL4     AU0780302chr1:
80150044-80150044
CTintergenicDe novo--Yuen2017 G
ADGRL4     1-0985-003chr1:
80037952-80037960
CATATATATCATATATintergenicDe novo--Yuen2017 G
ADGRL4     2-1094-004chr1:
80073281-80073281
CTintergenicDe novo--Yuen2017 G
ADGRL4     AU4223302chr1:
80824725-80824725
TCintergenicDe novo--Yuen2017 G
ADGRL4     AU3051303chr1:
79860775-79860775
GTintergenicDe novo--Yuen2017 G
ADGRL4     74-0450chr1:
79357261-79357261
TCexonicInheritednonsynonymous SNVNM_022159c.A1958Gp.N653S23.42.501E-5Patowary2019 E
ADGRL4     2-1252-003chr1:
79443912-79443912
AGintronicDe novo--Yuen2017 G
ADGRL4     AU3122301chr1:
80993014-80993014
TCintergenicDe novo--Yuen2017 G
ADGRL4     2-1353-003chr1:
80831261-80831261
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
ADGRL4     AU3051303chr1:
79632094-79632094
TCintergenicDe novo--Yuen2017 G
ADGRL4     A27chr1:
80720909-80720909
TCintergenicDe novo--Wu2018 G
ADGRL4     AU3874302chr1:
80429890-80429890
TAintergenicDe novo--Yuen2017 G
ADGRL4     14522.p1chr1:
79367812-79367812
AGintronicDe novo--Werling2018 G
ADGRL4     2-1562-003chr1:
80340818-80340818
AAACTintergenicDe novo--Yuen2017 G
ADGRL4     1-0253-004chr1:
79538191-79538191
TCintergenicDe novo--Yuen2017 G
ADGRL4     5-0055-004chr1:
80930189-80930190
ATAintergenicDe novo--Yuen2017 G
ADGRL4     2-1164-003chr1:
79572367-79572367
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
ADGRL4     AU4211304chr1:
80583120-80583120
ACintergenicDe novo--Yuen2017 G
ADGRL4     1-0045-004chr1:
80982767-80982767
CAintergenicDe novo--Yuen2017 G
ADGRL4     2-1277-004chr1:
80570219-80570219
CGintergenicDe novo--Yuen2017 G
ADGRL4     A2chr1:
79932604-79932604
AGintergenicDe novo--Wu2018 G
ADGRL4     1-0552-003chr1:
79766025-79766025
TCintergenicDe novo--Yuen2017 G
ADGRL4     1-0445-003chr1:
79583430-79583430
ATintergenicDe novo--Yuen2017 G
ADGRL4     AU006804chr1:
80845694-80845694
TCintergenicDe novo--Yuen2017 G
ADGRL4     5-0148-003chr1:
80796165-80796165
GAintergenicDe novo--Yuen2017 G
ADGRL4     2-1295-003chr1:
80789525-80789539
CGTGTGTGTGTGTGTCGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
ADGRL4     7-0102-003chr1:
80945007-80945007
GAintergenicDe novo--Yuen2017 G
ADGRL4     3-0111-000chr1:
80516697-80516697
CTintergenicDe novo--Yuen2016 G
ADGRL4     2-1526-003chr1:
79729528-79729528
TGintergenicDe novo--Yuen2017 G
ADGRL4     7-0100-004chr1:
79922209-79922209
CGintergenicDe novo--Yuen2017 G
ADGRL4     7-0100-004chr1:
80527254-80527254
AGintergenicDe novo--Yuen2017 G
ADGRL4     2-0285-004chr1:
80735524-80735524
GAintergenicDe novo--Yuen2017 G
ADGRL4     AU3859301chr1:
80631825-80631825
AGintergenicDe novo--Yuen2017 G
ADGRL4     7-0249-003chr1:
79356974-79356974
AGintronicDe novo--Yuen2017 G
ADGRL4     13638.p1chr1:
79392543-79392543
GTintronicMosaic--Dou2017 E
ADGRL4     5-0050-004chr1:
79402823-79402823
AGintronicDe novo--Yuen2017 G
ADGRL4     1-0373-003chr1:
79870122-79870122
TCintergenicDe novo--Yuen2017 G
ADGRL4     2-0102-004chr1:
80661339-80661339
AGintergenicDe novo--Yuen2017 G
ADGRL4     7-0151-003chr1:
79571743-79571743
ATintergenicDe novo--Yuen2017 G
ADGRL4     NDAR_INVCG000TG1_wes1chr1:
79474686-79474686
ATintergenicDe novo--Kosmicki2017 E
Satterstrom2020 E
ADGRL4     1-0150-004chr1:
80287625-80287625
CTintergenicDe novo--Yuen2017 G
ADGRL4     2-0129-004chr1:
79739475-79739475
GAintergenicDe novo--Yuen2017 G
ADGRL4     AU4473301chr1:
80505349-80505349
CGintergenicDe novo--Yuen2017 G
ADGRL4     2-1370-003chr1:
80592867-80592867
AGintergenicDe novo--Yuen2016 G
ADGRL4     1-0169-003chr1:
80129944-80129944
CTintergenicDe novo--Yuen2017 G
ADGRL4     1-0208-003chr1:
80945270-80945270
GAintergenicDe novo--Yuen2017 G
ADGRL4     1-0300-003chr1:
80395960-80395960
GCintergenicDe novo--Yuen2017 G
ADGRL4     2-1561-003chr1:
80004072-80004072
TGintergenicDe novo--Yuen2017 G
ADGRL4     AU3874301chr1:
80247478-80247478
CTintergenicDe novo--Yuen2017 G
ADGRL4     2-1461-003chr1:
80875278-80875278
CGintergenicDe novo--Yuen2017 G
ADGRL4     2-1411-003chr1:
80423189-80423203
GTATATATATATATAGTATATATATATAintergenicDe novo--Yuen2017 G
ADGRL4     2-1160-003chr1:
80941447-80941447
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
ADGRL4     1-0352-005chr1:
80593444-80593444
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More