or
or
Exact

Results for "LRFN2"

Variant Events: 33

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LRFN2     2-0149-004chr6:
40771069-40771069
AGintergenicDe novo--Yuen2017 G
LRFN2     AU031403chr6:
40734330-40734330
GAintergenicDe novo--Yuen2017 G
LRFN2     AU4159301chr6:
40797060-40797060
CTintergenicDe novo--Yuen2017 G
LRFN2     2-1632-003chr6:
40812333-40812333
ACintergenicDe novo--Yuen2017 G
LRFN2     2-1328-003chr6:
40425262-40425262
AAGCACCintronicDe novo--Yuen2016 G
LRFN2     AU2793301chr6:
40734810-40734810
GAintergenicDe novo--Yuen2017 G
LRFN2     AU2035301chr6:
40423371-40423371
GAintronicDe novo--Yuen2017 G
LRFN2     12493.p1chr6:
40361860-40361860
CGintronicDe novo--Turner2016 G
LRFN2     2-1522-003chr6:
40373368-40373368
GTintronicDe novo--Yuen2017 G
LRFN2     11002.p1chr6:
40691072-40691072
GAintergenicDe novo--Turner2016 G
LRFN2     1-0169-003chr6:
40622763-40622763
TTGGTGAintergenicDe novo--Yuen2017 G
LRFN2     1-0190-003chr6:
40749247-40749247
CTintergenicDe novo--Yuen2017 G
LRFN2     AU3779302chr6:
40640681-40640681
AGintergenicDe novo--Yuen2017 G
LRFN2     13393.p1chr6:
40784556-40784556
CTintergenicDe novo--Turner2016 G
LRFN2     72-1397chr6:
40400491-40400491
CTexonicInheritednonsynonymous SNVNM_020737c.G362Ap.R121Q18.422.475E-5Patowary2019 E
LRFN2     AU011604chr6:
40630869-40630869
TCintergenicDe novo--Yuen2017 G
LRFN2     2-1375-003chr6:
40572139-40572139
CAintergenicDe novo--Yuen2017 G
LRFN2     1-0292-005chr6:
40538790-40538790
GAintronicDe novo--Yuen2017 G
LRFN2     2-1178-003chr6:
40404734-40404750
AGTGTGTGTGTGTGTGTAGTGTGTGTGTGTGTintronicDe novo--Yuen2017 G
LRFN2     AU026412chr6:
40705513-40705513
GCintergenicDe novo--Yuen2017 G
LRFN2     11234.p1chr6:
40399693-40399693
CTexonicDe novononsynonymous SNVNM_020737c.G1160Ap.S387N0.993-Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
LRFN2     14477.p1chr6:
40400210-40400211
CACexonicDe novoframeshift deletionNM_020737c.642delTp.P214fs--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
LRFN2     1-0498-003chr6:
40542969-40542969
CTintronicDe novo--Yuen2017 G
LRFN2     2-0285-003chr6:
40604323-40604323
AGintergenicDe novo--Yuen2017 G
LRFN2     1-0458-005chr6:
40622721-40622721
TTGGCintergenicDe novo--Yuen2017 G
LRFN2     1-0936-003chr6:
40613981-40613981
GAintergenicDe novo--Yuen2017 G
LRFN2     1-0923-003chr6:
40440914-40440914
GAintronicDe novo--Yuen2017 G
LRFN2     2-1169-003chr6:
40622937-40622937
TTAGTAATAATGATGGTTACAintergenicDe novo--Yuen2017 G
LRFN2     2-1195-003chr6:
40703977-40703977
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LRFN2     1-0459-003chr6:
40719526-40719565
CCTCAGACTGGGGCTCCCTGAGGACGGGGCTGCGTCTGCTCintergenicDe novo--Yuen2017 G
LRFN2     AU2035302chr6:
40423371-40423371
GAintronicDe novo--Yuen2017 G
LRFN2     2-1440-003chr6:
40418318-40418318
CTintronicDe novo--Yuen2016 G
Yuen2017 G
LRFN2     AU4306302chr6:
40816387-40816387
AGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More