or
or
Exact

Results for "FSTL4"

Variant Events: 49

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FSTL4     7-0129-003chr5:
133141765-133141765
ACintergenicDe novo--Yuen2017 G
FSTL4     1-0049-004chr5:
132680809-132680809
CGintronicDe novo--Yuen2017 G
FSTL4     2-1734-003chr5:
132548218-132548218
TCintronicDe novo--Yuen2017 G
FSTL4     5-0017-004chr5:
132633405-132633405
TCintronicDe novo--Yuen2017 G
FSTL4     AU3506302chr5:
133122944-133122944
GTintergenicDe novo--Yuen2017 G
FSTL4     2-1086-003chr5:
132673403-132673403
GTintronicDe novo--Yuen2017 G
FSTL4     72-0745chr5:
132534876-132534876
AGexonicInheritednonsynonymous SNVNM_015082c.T2440Cp.F814L12.392.502E-5Patowary2019 E
FSTL4     2-1434-003chr5:
132618956-132618972
CTGTGTGTGTGTGTGTGCTGTGTGTGTGTGTGintronicDe novo--Yuen2017 G
FSTL4     AU2293302chr5:
132846810-132846810
AGintronicDe novo--Yuen2017 G
FSTL4     1-0107-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
FSTL4     1-0640-003chr5:
132630966-132630966
TAintronicDe novo--Yuen2017 G
FSTL4     AU1987302chr5:
132613708-132613708
AGintronicDe novo--Yuen2017 G
FSTL4     1-0104-003chr5:
132694148-132694148
CTintronicDe novo--Yuen2017 G
FSTL4     1-0498-003chr5:
132718136-132718155
CCCTCCTCCTCCTCCTCCTCCCCTCCTCCTCCTCCTCintronicDe novo--Yuen2017 G
FSTL4     2-1366-003chr5:
132984938-132984938
AGintergenicDe novo--Yuen2017 G
FSTL4     2-0304-004chr5:
132643415-132643416
ACAintronicDe novo--Yuen2017 G
FSTL4     1-0494-003Achr5:
133031258-133031258
TGintergenicDe novo--Yuen2017 G
FSTL4     1-0214-003chr5:
133103962-133103962
AGintergenicDe novo--Yuen2017 G
FSTL4     AU4344301chr5:
132712398-132712398
TCintronicDe novo--Yuen2017 G
FSTL4     AU4149301chr5:
132779729-132779729
GCintronicDe novo--Yuen2017 G
FSTL4     AU047703chr5:
133023359-133023359
GCintergenicDe novo--Yuen2017 G
FSTL4     1-0763-003chr5:
132834021-132834021
CTintronicDe novo--Yuen2017 G
FSTL4     2-0242-004chr5:
132755269-132755269
TCintronicDe novo--Yuen2017 G
FSTL4     AU4013301chr5:
132966412-132966412
CTintergenicDe novo--Yuen2017 G
FSTL4     1-0222-003chr5:
133028105-133028105
CTintergenicDe novo--Yuen2017 G
FSTL4     1-0441-003chr5:
132758935-132758935
CTintronicDe novo--Yuen2016 G
Yuen2017 G
FSTL4     2-1438-003chr5:
132626791-132626791
GAintronicDe novo--Yuen2016 G
Yuen2017 G
FSTL4     AU3761302chr5:
132626306-132626306
TCintronicDe novo--Yuen2017 G
FSTL4     AU3794301chr5:
132755089-132755089
CTintronicDe novo--Yuen2017 G
FSTL4     1-0494-003chr5:
133031258-133031258
TGintergenicDe novo--Yuen2017 G
FSTL4     AU015903chr5:
132873888-132873888
TCintronicDe novo--Yuen2017 G
FSTL4     AU2293301chr5:
132846810-132846810
AGintronicDe novo--Yuen2017 G
FSTL4     2-1066-003chr5:
132600999-132600999
GAintronicDe novo--Yuen2017 G
FSTL4     2-0319-004chr5:
132735850-132735850
ATintronicDe novo--Yuen2017 G
FSTL4     AU3720302chr5:
133160281-133160281
GAintergenicDe novo--Yuen2017 G
FSTL4     2-1629-003chr5:
133209677-133209677
GAintergenicDe novo--Yuen2017 G
FSTL4     1-0483-003chr5:
132775734-132775734
GAintronicDe novo--Yuen2016 G
FSTL4     7-0160-003chr5:
132684859-132684859
CGintronicDe novo--Yuen2017 G
FSTL4     1-0507-003chr5:
132676992-132676992
TGintronicDe novo--Yuen2016 G
Yuen2017 G
FSTL4     AU2089302chr5:
132601742-132601742
CTintronicDe novo--Yuen2017 G
FSTL4     2-0145-003chr5:
133066868-133066868
CGintergenicDe novo--Yuen2017 G
FSTL4     11212.p1chr5:
132712082-132712083
GGTTintronicMaternal--Wilfert2021 G
FSTL4     PN400111chr5:
132918981-132918981
GGCTTCTGAAintronicUnknown-0.0037Leblond2019 E
FSTL4     AU3891303chr5:
133037843-133037843
CTintergenicDe novo--Yuen2017 G
FSTL4     7-0024-005chr5:
133076324-133076324
CTintergenicDe novo--Yuen2017 G
FSTL4     2-1720-003chr5:
133076531-133076531
CTintergenicDe novo--Yuen2017 G
FSTL4     1-0197-003chr5:
132822829-132822829
TCintronicDe novo--Yuen2017 G
FSTL4     AU1223303chr5:
132759373-132759373
TCintronicDe novo--Yuen2017 G
FSTL4     1-0439-003chr5:
132577035-132577035
GTintronicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More