or
or
Exact

Results for "NBAS"

Variant Events: 61

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NBAS     AU2019302chr2:
15340535-15340535
ATintronicDe novo--Yuen2017 G
NBAS     DEASD_0021_001chr2:
15698779-15698783
CACTTCintronicDe novo--Kosmicki2017 E
NBAS     3-0409-000 Complex Event; expand row to view variants  De novononsynonymous SNV, synonymous SNVNM_015909
NM_015909
c.C5226T
c.A5225T
p.H1742H
p.H1742L
21.7-Tammimies2015 E
Tammimies2015 E
NBAS     11089.p1chr2:
15668449-15668449
ATintronicDe novo--Turner2016 G
NBAS     2-1581-003chr2:
15368223-15368223
CTintronicDe novo--Yuen2017 G
NBAS     AU2863302chr2:
15351656-15351656
CTintronicDe novo--Yuen2017 G
NBAS     SP0093602chr2:
15470857-15470857
ACexonicDe novosynonymous SNVNM_015909c.T4212Gp.A1404A12.54-Fu2022 E
NBAS     AU072904chr2:
15680901-15680901
CTintronicDe novo--Yuen2017 G
NBAS     iHART1739chr2:
15698725-15698726
TATexonicUnknownframeshift deletionNM_015909c.150delTp.F50fs--Ruzzo2019 G
NBAS     iHART1652chr2:
15698707-15698707
GAexonicPaternalstopgainNM_015909c.C169Tp.R57X37.0-Ruzzo2019 G
NBAS     iHART1738chr2:
15698725-15698726
TATexonicUnknownframeshift deletionNM_015909c.150delTp.F50fs--Ruzzo2019 G
NBAS     iHART1740chr2:
15698725-15698726
TATexonicUnknownframeshift deletionNM_015909c.150delTp.F50fs--Ruzzo2019 G
NBAS     iHART2051chr2:
15696945-15696945
TCsplicingPaternalsplicing18.171.652E-5Ruzzo2019 G
NBAS     iHART2049chr2:
15696945-15696945
TCsplicingPaternalsplicing18.171.652E-5Ruzzo2019 G
NBAS     Marques2022:174chr2:
15415865-15415865
TAexonicnonsynonymous SNVNM_015909c.A5467Tp.I1823F19.555.0E-4Marques2022 ET
NBAS     Marques2022:173chr2:
15415627-15415627
GAexonicnonsynonymous SNVNM_015909c.C5705Tp.S1902F24.5-Marques2022 ET
NBAS     Marques2022:176chr2:
15427225-15427225
GAexonicnonsynonymous SNVNM_015909c.C5110Tp.H1704Y17.242.0E-4Marques2022 ET
NBAS     Marques2022:175chr2:
15415865-15415865
TAexonicnonsynonymous SNVNM_015909c.A5467Tp.I1823F19.555.0E-4Marques2022 ET
NBAS     AU2000302chr2:
15697558-15697558
TCintronicDe novo--Yuen2017 G
NBAS     Marques2022:172chr2:
15374831-15374831
CTexonicnonsynonymous SNVNM_015909c.G5984Ap.R1995Q32.06.0E-4Marques2022 ET
NBAS     Marques2022:171chr2:
15359049-15359049
GTexonicnonsynonymous SNVNM_015909c.C6280Ap.P2094T26.68.343E-6Marques2022 ET
NBAS     Marques2022:182chr2:
15449305-15449305
GAexonicnonsynonymous SNVNM_015909c.C4649Tp.A1550V28.72.0E-4Marques2022 ET
NBAS     10001451004926525-Cchr2:
15618406-15618406
TCexonicDe novononsynonymous SNVNM_015909c.A1091Gp.Y364C13.176.738E-5Fu2022 E
NBAS     Marques2022:181chr2:
15448339-15448339
CTsplicingsplicing16.54-Marques2022 ET
NBAS     Marques2022:184chr2:
15467889-15467889
ACexonicnonsynonymous SNVNM_015909c.T4567Gp.F1523V21.7-Marques2022 ET
NBAS     Marques2022:183chr2:
15449305-15449305
GAexonicnonsynonymous SNVNM_015909c.C4649Tp.A1550V28.72.0E-4Marques2022 ET
NBAS     Marques2022:178chr2:
15427256-15427256
GCexonicstopgainNM_015909c.C5079Gp.Y1693X41.0-Marques2022 ET
NBAS     Marques2022:177chr2:
15427225-15427225
GAexonicnonsynonymous SNVNM_015909c.C5110Tp.H1704Y17.242.0E-4Marques2022 ET
NBAS     Marques2022:180chr2:
15432775-15432775
CTexonicnonsynonymous SNVNM_015909c.G4913Ap.R1638H18.160.003Marques2022 ET
NBAS     5-0015-003chr2:
15384441-15384441
AGintronicDe novo--Yuen2017 G
NBAS     Marques2022:179chr2:
15432775-15432775
CTexonicnonsynonymous SNVNM_015909c.G4913Ap.R1638H18.160.003Marques2022 ET
NBAS     Marques2022:190chr2:
15542374-15542374
CGexonicnonsynonymous SNVNM_015909c.G2989Cp.E997Q16.893.299E-5Marques2022 ET
NBAS     Marques2022:189chr2:
15534391-15534391
GAexonicnonsynonymous SNVNM_015909c.C3217Tp.R1073C16.180.0042Marques2022 ET
NBAS     Marques2022:192chr2:
15608634-15608634
CTexonicstopgainNM_015909c.G1749Ap.W583X40.08.256E-6Marques2022 ET
NBAS     Marques2022:191chr2:
15601387-15601387
ACexonicnonsynonymous SNVNM_015909c.T2277Gp.I759M15.9-Marques2022 ET
NBAS     AU066104chr2:
15578137-15578137
GAintronicDe novo--Yuen2017 G
NBAS     Marques2022:186chr2:
15493821-15493821
ATexonicnonsynonymous SNVNM_015909c.T3945Ap.S1315R15.068.26E-6Marques2022 ET
NBAS     2-1357-003chr2:
15385999-15385999
GCintronicDe novo--Yuen2017 G
NBAS     Marques2022:185chr2:
15470849-15470849
ACexonicnonsynonymous SNVNM_015909c.T4220Gp.L1407W16.88-Marques2022 ET
NBAS     Marques2022:188chr2:
15534391-15534391
GAexonicnonsynonymous SNVNM_015909c.C3217Tp.R1073C16.180.0042Marques2022 ET
NBAS     AU009805chr2:
15378161-15378161
ACintronicDe novo--Yuen2017 G
NBAS     AU3263302chr2:
15459049-15459049
CAintronicDe novo--Yuen2017 G
NBAS     Marques2022:187chr2:
15496498-15496498
AGexonicnonsynonymous SNVNM_015909c.T3860Cp.L1287S13.752.474E-5Marques2022 ET
NBAS     Marques2022:198chr2:
15651461-15651461
CAexonicnonsynonymous SNVNM_015909c.G760Tp.G254C13.51-Marques2022 ET
NBAS     Marques2022:197chr2:
15651412-15651412
CTexonicnonsynonymous SNVNM_015909c.G809Ap.G270D20.42.478E-5Marques2022 ET
NBAS     Marques2022:200chr2:
15676649-15676649
GCexonicnonsynonymous SNVNM_015909c.C540Gp.S180R9.5751.0E-4Marques2022 ET
NBAS     2-1267-003chr2:
15534689-15534689
TCintronicDe novo--Yuen2017 G
NBAS     Marques2022:199chr2:
15676570-15676570
GAexonicstopgainNM_015909c.C619Tp.R207X37.0-Marques2022 ET
NBAS     Marques2022:194chr2:
15615936-15615936
AGexonicnonsynonymous SNVNM_015909c.T1216Cp.C406R11.924.949E-5Marques2022 ET
NBAS     Marques2022:193chr2:
15614282-15614282
GAexonicnonsynonymous SNVNM_015909c.C1508Tp.A503V23.9-Marques2022 ET
NBAS     Marques2022:196chr2:
15618404-15618404
CGexonicnonsynonymous SNVNM_015909c.G1093Cp.D365H17.350.0088Marques2022 ET
NBAS     547-09-112297chr2:
15506799-15506799
CGexonicDe novononsynonymous SNVNM_015909c.G3722Cp.R1241P20.2-Fu2022 E
Satterstrom2020 E
NBAS     Marques2022:195chr2:
15618404-15618404
CGexonicnonsynonymous SNVNM_015909c.G1093Cp.D365H17.350.0088Marques2022 ET
NBAS     SP0002235chr2:
15618415-15618415
TAsplicingDe novosplicing24.4-Feliciano2019 E
NBAS     Marques2022:201chr2:
15696945-15696945
TCsplicingsplicing18.171.652E-5Marques2022 ET
NBAS     052-09-110820chr2:
15613325-15613325
TCintronicDe novo--Satterstrom2020 E
NBAS     DEASD_1009_001chr2:
15618354-15618354
GCexonicDe novononsynonymous SNVNM_015909c.C1143Gp.I381M11.418.327E-6Fu2022 E
Satterstrom2020 E
NBAS     2-1241-003chr2:
15513092-15513104
GCACACACACACAGCACACACACAintronicDe novo--Yuen2017 G
NBAS     AU003406chr2:
15404963-15404963
CTintronicDe novo--Yuen2017 G
NBAS     1-0265-003chr2:
15708069-15708069
GAintergenicDe novo--Yuen2017 G
NBAS     1-0978-003chr2:
15583370-15583370
AGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More