Variant Results

or

or

Results for "PROM2"

Variant Events: 9

Gene Gene symbol on which the variant is located	ID Subject Identifier from the original study	Location Genomic location of the reference allele	REF Reference allele	ALT Alternate allele	Context Variant functional categories	Variant validation performed by an orthogonal method and reported	Inheritance Reported inheritance status	Effects Variant effect on transcript per Annovar	Transcript Transcript used for the cDNA/Protein mutation	cDNA cDNA variant notation	Protein Protein variant notation	CADD-Phred v1.0 CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores	ExAC v0.3 ExAC population frequency (version 0.3)	Sources Source(s) where variants from this event are reported
PROM2	SP0105319	chr2: 95954617-95954617	C	T	intronic		De novo					-	-	Fu2022 E
PROM2	SP0033474	chr2: 95947863-95947863	T	A	intronic		De novo					-	-	Fu2022 E
PROM2	NDAR_INVWB513RW6_wes1	chr2: 95943281-95943281	C	A	exonic		De novo	synonymous SNV	NM_001165977 NM_001165978 NM_144707	c.C942A c.C942A c.C942A	p.A314A p.A314A p.A314A	-	-	DeRubeis2014 E Fu2022 E Kosmicki2017 E Satterstrom2020 E Trost2022 G Zhou2022 GE
PROM2	mAGRE5091	chr2: 95954338-95954338	G	A	splicing		Maternal	splicing				18.71	8.318E-6	Cirnigliaro2023 G
PROM2	mAGRE4782	chr2: 95944832-95944833	AG	A	exonic		Paternal	frameshift deletion	NM_001165977 NM_001165978 NM_144707	c.1215delG c.1215delG c.1215delG	p.Q405fs p.Q405fs p.Q405fs	-	4.0E-4	Cirnigliaro2023 G
PROM2	mAGRE2966	chr2: 95942810-95942810	G	A	splicing		Maternal	splicing				14.92	-	Cirnigliaro2023 G
PROM2	2-1176-003	chr2: 95958253-95958253	C	T	intergenic		De novo					-	-	Yuen2017 G
PROM2	1-0490-003	chr2: 95959934-95959966	TTCTCTCTCTCTCTCTGTCTCTCTCTCTCTCTC	TTCTCTCTCTCTCTGTCTCTCTCTCTCTCTC	intergenic		De novo					-	-	Yuen2017 G
PROM2	iHART2966	chr2: 95942810-95942810	G	A	splicing		Maternal	splicing				14.92	-	Ruzzo2019 G

Source Variant Information

, -

Source:

Paper alias:

No records found.

Paper Information

Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count	The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notes	View
	More