Variant Results

or

or

Results for "CCDC24"

Variant Events: 6

Gene Gene symbol on which the variant is located	ID Subject Identifier from the original study	Location Genomic location of the reference allele	REF Reference allele	ALT Alternate allele	Context Variant functional categories	Variant validation performed by an orthogonal method and reported	Inheritance Reported inheritance status	Effects Variant effect on transcript per Annovar	Transcript Transcript used for the cDNA/Protein mutation	cDNA cDNA variant notation	Protein Protein variant notation	CADD-Phred v1.0 CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores	ExAC v0.3 ExAC population frequency (version 0.3)	Sources Source(s) where variants from this event are reported
CCDC24	2-1164-003	chr1: 44458910-44458935	TGAGATCAGCCTGGGCAATACAGGGA	T	intronic		De novo					-	-	Yuen2016 G
CCDC24	mAGRE2390	chr1: 44461657-44461673	CCCTCTGCGGGGTTGCA	C	exonic		Maternal	frameshift deletion	NM_152499	c.750_765del	p.P250fs	-	2.476E-5	Cirnigliaro2023 G
CCDC24	mAGRE4668	chr1: 44461479-44461479	C	T	exonic		Maternal	stopgain	NM_152499	c.C652T	p.Q218X	32.0	-	Cirnigliaro2023 G
CCDC24	mAGRE4507	chr1: 44458193-44458193	A	G	splicing		Maternal	splicing				15.69	8.242E-6	Cirnigliaro2023 G
CCDC24	iHART2390	chr1: 44461657-44461673	CCCTCTGCGGGGTTGCA	C	exonic		Maternal	frameshift deletion	NM_152499	c.750_765del	p.P250fs	-	2.476E-5	Ruzzo2019 G
CCDC24	ASDFI_1628	chr1: 44458012-44458012	C	T	exonic		De novo	synonymous SNV	NM_152499	c.C255T	p.L85L	-	-	DeRubeis2014 E Fu2022 E Kosmicki2017 E Lim2017 E Satterstrom2020 E Trost2022 G Zhou2022 GE

Source Variant Information

, -

Source:

Paper alias:

No records found.

Paper Information

Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count	The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notes	View
	More