or
or
Exact

Results for "KALRN"

Variant Events: 28

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KALRN     2-0129-004chr3:
123853923-123853923
CTintronicDe novo--Yuen2017 G
KALRN     AU4468301chr3:
123984995-123984995
CTintronicDe novo--Yuen2017 G
KALRN     5-0003-004chr3:
124159877-124159877
ATintronicDe novo--Yuen2017 G
KALRN     1-0303-004chr3:
123828512-123828512
GGACATATATATCintronicDe novo--Yuen2017 G
KALRN     5-0099-003chr3:
124186775-124186775
GAintronicDe novo--Yuen2017 G
KALRN     2-0295-004chr3:
124337762-124337762
CAintronicDe novo--Yuen2017 G
KALRN     2-0198-003chr3:
124066642-124066662
GGTTGAATGTGCCCAGAGAACGintronicDe novo--Yuen2017 G
KALRN     1-0384-003chr3:
124196354-124196354
TCintronicDe novo--Yuen2017 G
KALRN     AU050910chr3:
124400842-124400842
CTintronicDe novo--Yuen2017 G
KALRN     2-0145-004chr3:
124027378-124027378
GAintronicDe novo--Yuen2017 G
KALRN     AU0780302chr3:
124153589-124153589
TAintronicDe novo--Yuen2017 G
KALRN     1-0985-003chr3:
124105081-124105081
AGintronicDe novo--Yuen2017 G
KALRN     2-1497-003chr3:
124114482-124114482
TCintronicDe novo--Yuen2017 G
KALRN     13008.p1chr3:
124281800-124281800
CTexonicDe novosynonymous SNVNM_001024660c.C5040Tp.S1680S9.4815.027E-5Iossifov2014 E
Kosmicki2017 E
O’Roak2012b E
Satterstrom2020 E
Wilfert2021 G
KALRN     11229.p1chr3:
124385248-124385248
TTCintronicDe novo--Satterstrom2020 E
KALRN     2-1353-003chr3:
124004933-124004933
TCintronicDe novo--Yuen2017 G
KALRN     2-1361-003chr3:
124085592-124085592
CTintronicDe novo--Yuen2017 G
KALRN     1-0104-004chr3:
123828512-123828512
GGACATATATATCintronicDe novo--Yuen2017 G
KALRN     1-0200-004chr3:
124147379-124147379
GCintronicDe novo--Yuen2017 G
KALRN     1-0629-003chr3:
123814891-123814891
AGintronicDe novo--Yuen2017 G
KALRN     11928.p1chr3:
124149657-124149657
CTintronicMosaic-0.0197Dou2017 E
KALRN     2-0198-004chr3:
124066642-124066662
GGTTGAATGTGCCCAGAGAACGintronicDe novo--Yuen2017 G
KALRN     2-1148-004chr3:
124145493-124145493
GCintronicDe novo--Yuen2017 G
KALRN     AU2793303chr3:
124288022-124288022
GAintronicDe novo--Yuen2017 G
KALRN     AU4089301chr3:
124322489-124322489
AGintronicDe novo--Yuen2017 G
KALRN     2-1427-003chr3:
124095952-124095952
TCintronicDe novo--Yuen2017 G
KALRN     PN400117chr3:
124377314-124377314
AGexonicDe novononsynonymous SNVNM_007064
NM_001024660
c.A979G
c.A6070G
p.N327D
p.N2024D
24.0-Leblond2019 E
KALRN     21189-33353chr3:
124281892-124281892
CTexonicInheritednonsynonymous SNVNM_001024660c.C5132Tp.S1711F25.5-Callaghan2019 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More