or
or
Exact

Results for "HNF1B"

Variant Events: 20

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
HNF1B     A12chr17:
36184346-36184346
CGintergenicDe novo--Wu2018 G
HNF1B     ASC_CA_59_Achr17:
36093838-36093838
TGintronicDe novo--Satterstrom2020 E
HNF1B     2-1442-003chr17:
36108273-36108273
GAintergenicDe novo--Yuen2016 G
HNF1B     1-0640-003chr17:
36156382-36156389
GCCACCACGCCACintergenicDe novo--Yuen2017 G
HNF1B     5-0015-003chr17:
36060593-36060593
TCintronicDe novo--Yuen2017 G
HNF1B     21799-35302chr17:
36070588-36070588
TTGGGGGexonicframeshift insertionNM_000458
NM_001165923
NM_001304286
c.1128_1129insCCCCC
c.1050_1051insCCCCC
c.1050_1051insCCCCC
p.S377fs
p.S351fs
p.S351fs
--Callaghan2019 G
HNF1B     AU074503chr17:
36107505-36107505
TCintergenicDe novo--Yuen2017 G
HNF1B     21236-33440chr17:
36070588-36070588
TTGGGGGexonicframeshift insertionNM_000458
NM_001165923
NM_001304286
c.1128_1129insCCCCC
c.1050_1051insCCCCC
c.1050_1051insCCCCC
p.S377fs
p.S351fs
p.S351fs
--Callaghan2019 G
HNF1B     DEASD_1012_001chr17:
36104918-36104918
TGUTR5De novo--Satterstrom2020 E
HNF1B     1-0534-006chr17:
36103386-36103386
CTintronicDe novo--Yuen2017 G
HNF1B     AU074503chr17:
36156382-36156389
GCCACCACGCCACintergenicDe novo--Yuen2017 G
HNF1B     21801-35317chr17:
36070588-36070588
TTGGGGGexonicframeshift insertionNM_000458
NM_001165923
NM_001304286
c.1128_1129insCCCCC
c.1050_1051insCCCCC
c.1050_1051insCCCCC
p.S377fs
p.S351fs
p.S351fs
--Callaghan2019 G
HNF1B     1565-22223chr17:
36070588-36070588
TTGGGGGexonicframeshift insertionNM_000458
NM_001165923
NM_001304286
c.1128_1129insCCCCC
c.1050_1051insCCCCC
c.1050_1051insCCCCC
p.S377fs
p.S351fs
p.S351fs
--Callaghan2019 G
HNF1B     1034-19683chr17:
36070588-36070588
TTGGGGGexonicframeshift insertionNM_000458
NM_001165923
NM_001304286
c.1128_1129insCCCCC
c.1050_1051insCCCCC
c.1050_1051insCCCCC
p.S377fs
p.S351fs
p.S351fs
--Callaghan2019 G
HNF1B     1999-24135chr17:
36070588-36070588
TTGGGGGexonicframeshift insertionNM_000458
NM_001165923
NM_001304286
c.1128_1129insCCCCC
c.1050_1051insCCCCC
c.1050_1051insCCCCC
p.S377fs
p.S351fs
p.S351fs
--Callaghan2019 G
HNF1B     G01-GEA-311-HIchr17:
36104918-36104918
TGUTR5De novo--Satterstrom2020 E
HNF1B     1972-24038chr17:
36070588-36070588
TTGGGGGexonicframeshift insertionNM_000458
NM_001165923
NM_001304286
c.1128_1129insCCCCC
c.1050_1051insCCCCC
c.1050_1051insCCCCC
p.S377fs
p.S351fs
p.S351fs
--Callaghan2019 G
HNF1B     1-0652-003chr17:
36168765-36168765
TCintergenicDe novo--Yuen2017 G
HNF1B     2-1497-003chr17:
36084359-36084359
CTintronicDe novo--Yuen2017 G
HNF1B     2-1442-003chr17:
36123071-36123084
GATATATATATATAGATATATATATAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More