or
or
Exact

Results for "PITPNM2"

Variant Events: 12

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PITPNM2     1-0158-012chr12:
123638429-123638451
CTTAATGAAAGGAGTTTTCTTATCintergenicDe novo--Yuen2017 G
PITPNM2     5-0074-003chr12:
123539820-123539820
CTintronicDe novo--Yuen2017 G
PITPNM2     12729.p1chr12:
123494628-123494628
TTGintronicDe novo--Satterstrom2020 E
PITPNM2     12011.p1chr12:
123557659-123557659
CTintronicDe novo--Turner2016 G
PITPNM2     3-0448-000chr12:
123601441-123601441
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
PITPNM2     ASDFI_1120chr12:
123470840-123470840
GAexonicDe novononsynonymous SNVNM_001300801
NM_020845
c.C3766T
c.C3784T
p.R1256W
p.R1262W
15.412.476E-5DeRubeis2014 E
Kosmicki2017 E
PITPNM2     AU3586303chr12:
123627844-123627844
ACintergenicDe novo--Yuen2017 G
PITPNM2     AC640.101chr12:
123489035-123489035
CTexonicDe novosynonymous SNVNM_001300801
NM_020845
c.G954A
c.G954A
p.A318A
p.A318A
-8.573E-6DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
PITPNM2     1792-23269chr12:
123480051-123480051
CTexonicInheritednonsynonymous SNVNM_001300801
NM_020845
c.G1939A
c.G1939A
p.D647N
p.D647N
34.0-Callaghan2019 G
PITPNM2     14409.p1chr12:
123470973-123470973
GAintronicDe novo-1.0E-4Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
PITPNM2     2-1164-003chr12:
123496461-123496461
TAintronicDe novo--Yuen2016 G
Yuen2017 G
PITPNM2     21762-34808chr12:
123519119-123519119
GAexonicInheritednonsynonymous SNVNM_001300801
NM_020845
c.C19T
c.C19T
p.R7W
p.R7W
26.8-Callaghan2019 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More