or
or
Exact

Results for "TENM2"

Variant Events: 73

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TENM2     5-0140-003chr5:
167691547-167691547
AGdownstreamDe novo--Yuen2017 G
TENM2     7-0102-003chr5:
167030315-167030315
GAintronicDe novo--Yuen2017 G
TENM2     AU4264302chr5:
166500063-166500063
TCintergenicDe novo--Yuen2017 G
TENM2     Cukier2014:7590chr5:
167474474-167474474
AGexonicUnknownnonsynonymous SNVNM_001122679c.A1229Gp.D410G16.210.0111Cukier2014 E
TENM2     7-0161-003chr5:
166630659-166630659
TCintergenicDe novo--Yuen2017 G
TENM2     2-1241-003chr5:
167601508-167601510
TCATintronicDe novo--Yuen2016 G
Yuen2017 G
TENM2     AU3849303chr5:
167066365-167066365
CAintronicDe novo--Yuen2017 G
TENM2     2-1345-003chr5:
166611195-166611195
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
TENM2     AU2458303chr5:
167182386-167182386
AGintronicDe novo--Yuen2017 G
TENM2     AU057405chr5:
167408716-167408716
GTintronicDe novo--Yuen2017 G
TENM2     5-0099-003chr5:
167297121-167297121
TGintronicDe novo--Yuen2017 G
TENM2     1-0104-003chr5:
167017358-167017358
GAintronicDe novo--Yuen2017 G
TENM2     2-1362-004chr5:
167193646-167193646
CCTintronicDe novo--Yuen2017 G
TENM2     AU049304chr5:
166972830-166972830
GAintronicDe novo--Yuen2017 G
TENM2     19890-31485chr5:
167673943-167673943
AGexonicInheritednonsynonymous SNVNM_001080428
NM_001122679
c.A5282G
c.A5972G
p.Y1761C
p.Y1991C
14.19-Callaghan2019 G
TENM2     AU3051302chr5:
167364731-167364731
CTintronicDe novo--Yuen2017 G
TENM2     1-0300-003chr5:
167490603-167490603
TCintronicDe novo--Yuen2017 G
TENM2     60-2027chr5:
167400872-167400872
AGintronicDe novo--Michaelson2012 G
TENM2     AU4429301chr5:
167588052-167588052
CTintronicDe novo--Yuen2017 G
TENM2     2-1389-003chr5:
167513754-167513754
GAintronicDe novo--Yuen2016 G
Yuen2017 G
TENM2     12014.p1chr5:
167525141-167525141
CTintronicDe novo-2.832E-5Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
TENM2     11044.p1chr5:
167553867-167553867
GTexonicDe novononsynonymous SNVNM_001080428
NM_001122679
c.G1622T
c.G2318T
p.R541L
p.R773L
14.64-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
TENM2     AU1764301chr5:
167534730-167534730
GTintronicDe novo--Yuen2017 G
TENM2     14032.p1chr5:
167689454-167689454
CTexonicDe novononsynonymous SNVNM_001080428
NM_001122679
c.C7247T
c.C7937T
p.T2416M
p.T2646M
16.07-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
TENM2     AU1952305chr5:
167268970-167268970
ACintronicDe novo--Yuen2017 G
TENM2     1-0255-003chr5:
166873301-166873301
ACintronicDe novo--Yuen2016 G
TENM2     1-0075-003chr5:
167612457-167612487
GATCATCATCATCATCAACATCATCATCATCGATCATCATCATCAACATCATCATCATCintronicDe novo--Yuen2017 G
TENM2     AU030Achr5:
167653125-167653125
CTexonicDe novononsynonymous SNVNM_001080428
NM_001122679
c.C4424T
c.C5114T
p.T1475M
p.T1705M
27.28.781E-5Satterstrom2020 E
TENM2     7-0059-003chr5:
167267117-167267117
CAintronicDe novo--Yuen2017 G
TENM2     2-0016-003chr5:
166866884-166866884
GAintronicDe novo--Yuen2017 G
TENM2     AU2433302chr5:
166624784-166624784
CTintergenicDe novo--Yuen2017 G
TENM2     2-1438-003chr5:
167650597-167650597
CTintronicDe novo--Yuen2016 G
Yuen2017 G
TENM2     AU2140306chr5:
166977112-166977112
ATintronicDe novo--Yuen2017 G
TENM2     1-0125-003chr5:
167054213-167054213
GCintronicDe novo--Yuen2017 G
TENM2     1-0763-003chr5:
167136572-167136572
CAintronicDe novo--Yuen2017 G
TENM2     AU3907301chr5:
166780860-166780862
CGGCGintronicDe novo--Yuen2017 G
TENM2     1-0125-003chr5:
167053812-167053812
CGintronicDe novo--Yuen2017 G
TENM2     2-1338-003chr5:
166652688-166652689
ATAintergenicDe novo--Yuen2017 G
TENM2     2-0110-003chr5:
167513456-167513456
CAintronicDe novo--Yuen2016 G
Yuen2017 G
TENM2     1-0636-003chr5:
166766496-166766496
GTintronicDe novo--Yuen2017 G
TENM2     2-0110-003chr5:
166683544-166683544
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
TENM2     1-0530-003chr5:
167584924-167584943
GTGTTGTTGTTGTTGTTGTTGTGTTGTTGTTGTTGTTintronicDe novo--Yuen2017 G
TENM2     11341.p1chr5:
166473545-166473545
AGintergenicDe novo--Turner2016 G
TENM2     AU4260303chr5:
167589773-167589773
GAintronicDe novo-3.0E-4Yuen2017 G
TENM2     14642.p1chr5:
167655695-167655695
GAintronicDe novo--Turner2016 G
TENM2     1-0186-005chr5:
167538254-167538254
GAintronicDe novo--Yuen2017 G
TENM2     11252.p1chr5:
166816546-166816546
AGintronicDe novo--Turner2016 G
TENM2     12011.p1chr5:
167237481-167237481
CAintronicDe novo--Turner2016 G
TENM2     2-0298-003chr5:
166891249-166891249
TTAGAGintronicDe novo--Yuen2017 G
TENM2     1-0065-005chr5:
167208832-167208832
GCintronicDe novo--Yuen2017 G
TENM2     2-1283-004chr5:
166443245-166443245
CTintergenicDe novo--Yuen2017 G
TENM2     2-1254-003chr5:
167256626-167256626
AGintronicDe novo--Yuen2016 G
TENM2     2-1399-003chr5:
166855212-166855212
TAintronicDe novo--Yuen2017 G
TENM2     AU2072302chr5:
167393080-167393080
AGintronicDe novo--Yuen2017 G
TENM2     1-0404-003chr5:
167421748-167421748
TAintronicDe novo--Yuen2017 G
TENM2     AU056804chr5:
166488850-166488850
GTintergenicDe novo--Yuen2017 G
TENM2     1-0401-003chr5:
166816611-166816611
GGTGATintronicDe novo--Yuen2017 G
TENM2     AU056204chr5:
167704578-167704578
GCintergenicDe novo--Yuen2017 G
TENM2     AU2140305chr5:
166690816-166690816
ATintergenicDe novo--Yuen2017 G
TENM2     AU3263302chr5:
167456392-167456392
GAintronicDe novo--Yuen2017 G
TENM2     1-0321-004chr5:
166407672-166407672
TAintergenicDe novo--Yuen2017 G
TENM2     2-1350-003chr5:
166555222-166555222
AGintergenicDe novo--Yuen2017 G
TENM2     1-0224-004chr5:
167469951-167469951
AGintronicDe novo--Yuen2017 G
TENM2     5-0109-003chr5:
166393651-166393651
GAintergenicDe novo--Yuen2017 G
TENM2     2-1258-003chr5:
166985011-166985011
GAintronicDe novo--Yuen2017 G
TENM2     AU021204chr5:
167314043-167314043
TCintronicDe novo--Yuen2017 G
TENM2     AU4069302chr5:
166496706-166496719
GTGGTTATCATTGGGTGGintergenicDe novo--Yuen2017 G
TENM2     2-1283-003chr5:
166443245-166443245
CTintergenicDe novo--Yuen2017 G
TENM2     1-0041-003chr5:
166627669-166627669
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
TENM2     7-0174-003chr5:
166803027-166803027
AGintronicDe novo--Yuen2017 G
TENM2     1-0402-004chr5:
167011229-167011229
GAintronicDe novo--Yuen2017 G
TENM2     AU4433301chr5:
167486533-167486533
GAintronicDe novo--Yuen2017 G
TENM2     2-1305-003chr5:
167650098-167650098
ATintronicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More