or
or
Exact

Results for "INSR"

Variant Events: 24

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
INSR     AU2248301chr19:
7238152-7238152
CTintronicDe novo--Yuen2017 G
INSR     1-0225-003chr19:
7276992-7276992
TCintronicDe novo--Yuen2017 G
INSR     1-0534-004chr19:
7431716-7431716
AGintergenicDe novo--Yuen2017 G
INSR     13826.p1chr19:
7119480-7119480
GAexonicDe novosynonymous SNVNM_001079817
NM_000208
c.C3738T
c.C3774T
p.P1246P
p.P1258P
--Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
INSR     14679.p1chr19:
7184382-7184382
GTexonicDe novononsynonymous SNVNM_000208
NM_001079817
c.C919A
c.C919A
p.H307N
p.H307N
17.69-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
INSR     14590.p1chr19:
7170089-7170089
GAintronicDe novo--Turner2016 G
INSR     1-0585-003chr19:
7276193-7276193
GTintronicDe novo--Yuen2017 G
INSR     DEASD_1007_001chr19:
7174751-7174751
GAintronicDe novo-1.758E-5Satterstrom2020 E
INSR     1-0279-004chr19:
7196067-7196067
CTintronicDe novo--Yuen2017 G
INSR     1-0572-003chr19:
7458084-7458084
AGintergenicDe novo--Yuen2017 G
INSR     2-0299-005chr19:
7188284-7188284
CTintronicDe novo--Yuen2017 G
INSR     21740-34579chr19:
7172377-7172377
GAexonicInheritednonsynonymous SNVNM_000208
NM_001079817
c.C1192T
c.C1192T
p.R398C
p.R398C
19.56-Callaghan2019 G
INSR     1-0526-003chr19:
7449604-7449604
GGTCintergenicDe novo--Yuen2017 G
INSR     2-0182-003chr19:
7169444-7169444
GAintronicDe novo--Yuen2017 G
INSR     1-0417-003chr19:
7151720-7151720
AGintronicDe novo--Yuen2017 G
INSR     AU2293301chr19:
7122131-7122131
CCAACAintronicDe novo--Yuen2017 G
INSR     SSC12779chr19:
7184382-7184382
GTexonicDe novononsynonymous SNVNM_000208
NM_001079817
c.C919A
c.C919A
p.H307N
p.H307N
17.69-Lim2017 E
INSR     AU039304chr19:
7262961-7262961
GTintronicDe novo--Yuen2017 G
INSR     AU1542301chr19:
7238030-7238030
GCintronicDe novo--Yuen2017 G
INSR     1-0490-003chr19:
7174755-7174768
CAGAGAGAGAGAGACAGAGAGAGAGAintronicDe novo--Yuen2017 G
INSR     2-1264-003chr19:
7157136-7157136
CTintronicDe novo--Yuen2016 G
Yuen2017 G
INSR     1876-23644chr19:
7267787-7267787
CAexonicnonsynonymous SNVNM_000208
NM_001079817
c.G221T
c.G221T
p.R74L
p.R74L
19.11-Callaghan2019 G
INSR     2-1245-003chr19:
7400333-7400333
ACintergenicDe novo--Yuen2017 G
INSR     AU4033303chr19:
7247632-7247632
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More