or
or
Exact

Results for "DNMT3A"

Variant Events: 51

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DNMT3A     SP0067705chr2:
25457176-25457176
GAexonicDe novononsynonymous SNVNM_153759
NM_022552
NM_175629
c.C2144T
c.C2711T
c.C2711T
p.P715L
p.P904L
p.P904L
19.879.067E-5Fu2022 E
Trost2022 G
Zhou2022 GE
DNMT3A     SP0046628chr2:
25464501-25464501
GAexonicDe novononsynonymous SNVNM_153759
NM_022552
NM_175629
c.C1445T
c.C2012T
c.C2012T
p.T482M
p.T671M
p.T671M
23.1-Fu2022 E
Trost2022 G
Zhou2022 GE
DNMT3A     SP0046030chr2:
25470382-25470382
TGintronicDe novo--Fu2022 E
Trost2022 G
DNMT3A     SP0057357chr2:
25467472-25467472
GGACTGGTAGCCGTCGTCGTCGTexonicDe novononframeshift insertionNM_153759
NM_022552
NM_175629
c.1036_1037insACGACGACGACGGCTACCAGT
c.1603_1604insACGACGACGACGGCTACCAGT
c.1603_1604insACGACGACGACGGCTACCAGT
p.S346delinsYDDDGYQS
p.S535delinsYDDDGYQS
p.S535delinsYDDDGYQS
--Fu2022 E
Zhou2022 GE
DNMT3A     SP0064047chr2:
25470030-25470030
GCintronicDe novo--Fu2022 E
Trost2022 G
Zhou2022 GE
DNMT3A     SSC11761chr2:
25457176-25457176
GAexonicDe novononsynonymous SNVNM_153759
NM_022552
NM_175629
c.C2144T
c.C2711T
c.C2711T
p.P715L
p.P904L
p.P904L
19.879.067E-5Chan2022 G
DNMT3A     1-0287-003chr2:
25479268-25479268
CTintronicDe novo--Trost2022 G
DNMT3A     MT_195.3chr2:
25456999-25456999
GAUTR3De novo--Trost2022 G
DNMT3A     2-1276-003chr2:
25466800-25466800
GAexonicDe novononsynonymous SNVNM_153759
NM_022552
NM_175629
c.C1336T
c.C1903T
c.C1903T
p.R446W
p.R635W
p.R635W
28.09.526E-5Jiang2013 G
Yuen2016 G
Yuen2017 G
Zhou2022 GE
DNMT3A     SSC06306chr2:
25505356-25505356
AATexonicDe novoframeshift insertionNM_022552
NM_175629
NM_175630
c.401dupA
c.401dupA
c.401dupA
p.N134fs
p.N134fs
p.N134fs
--Trost2022 G
DNMT3A     10-0007-003chr2:
25492132-25492132
GTintronicDe novo--Trost2022 G
DNMT3A     AU063004chr2:
25561431-25561431
GAintronicDe novo--Trost2022 G
Yuen2017 G
DNMT3A     Husson2020:328chr2:
25471016-25471016
GAexonicstopgainNM_153759
NM_022552
NM_175629
c.C178T
c.C745T
c.C745T
p.Q60X
p.Q249X
p.Q249X
40.08.24E-6Husson2020 E
DNMT3A     AU2328301chr2:
25455603-25455603
GAdownstreamDe novo--Trost2022 G
DNMT3A     MSSNG00253-003chr2:
25523557-25523557
TCintronicDe novo--Trost2022 G
DNMT3A     7-0329-003chr2:
25514394-25514394
TCintronicDe novo--Trost2022 G
DNMT3A     AU2463301chr2:
25554769-25554769
CTintronicDe novo--Trost2022 G
DNMT3A     80001101008chr2:
25468153-25468153
AGexonicDe novononsynonymous SNVNM_153759
NM_022552
NM_175629
c.T956C
c.T1523C
c.T1523C
p.L319P
p.L508P
p.L508P
23.9-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
DNMT3A     2-1467-003chr2:
25463289-25463289
TCexonicDe novononsynonymous SNVNM_153759
NM_022552
NM_175629
c.A1637G
c.A2204G
c.A2204G
p.Y546C
p.Y735C
p.Y735C
21.31.0E-4Trost2022 G
Zhou2022 GE
DNMT3A     2-1567-003chr2:
25556272-25556272
CTintronicDe novo--Trost2022 G
Yuen2017 G
DNMT3A     14065.p1chr2:
25511797-25511797
CAintronicDe novo--Wilfert2021 G
DNMT3A     2-1475-003chr2:
25580688-25580688
CGintergenicDe novo--Yuen2017 G
DNMT3A     IGM5219chr2:
25463195-25463197
CTTCexonicDe novoframeshift deletionNM_153759
NM_022552
NM_175629
c.1729_1730del
c.2296_2297del
c.2296_2297del
p.K577fs
p.K766fs
p.K766fs
-1.65E-5Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
DNMT3A     DEASD_0131_001chr2:
25463289-25463289
TCexonicDe novononsynonymous SNVNM_153759
NM_022552
NM_175629
c.A1637G
c.A2204G
c.A2204G
p.Y546C
p.Y735C
p.Y735C
21.31.0E-4DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
DNMT3A     2-1314-003chr2:
25483814-25483814
GAintronicDe novo--Yuen2016 G
DNMT3A     SSC06157chr2:
25464520-25464520
CAexonicDe novononsynonymous SNVNM_153759
NM_022552
NM_175629
c.G1426T
c.G1993T
c.G1993T
p.V476L
p.V665L
p.V665L
33.08.343E-6Fu2022 E
Lim2017 E
DNMT3A     Mahjani2021:92chr2:
25468153-25468153
AGexonicnonsynonymous SNVNM_153759
NM_022552
NM_175629
c.T956C
c.T1523C
c.T1523C
p.L319P
p.L508P
p.L508P
23.9-Mahjani2021 E
DNMT3A     Krgovic2022:040054chr2:
25464544-25464544
CTexonicUnknownnonsynonymous SNVNM_153759
NM_022552
NM_175629
c.G1402A
c.G1969A
c.G1969A
p.V468M
p.V657M
p.V657M
22.68.464E-5Krgovic2022 E
DNMT3A     14336.p1chr2:
25457176-25457176
GAexonicDe novononsynonymous SNVNM_153759
NM_022552
NM_175629
c.C2144T
c.C2711T
c.C2711T
p.P715L
p.P904L
p.P904L
19.879.067E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
Zhou2022 GE
DNMT3A     12512.p1chr2:
25464520-25464520
CAexonicDe novononsynonymous SNVNM_153759
NM_022552
NM_175629
c.G1426T
c.G1993T
c.G1993T
p.V476L
p.V665L
p.V665L
33.08.343E-6Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Wilfert2021 G
Zhou2022 GE
DNMT3A     12311.p1 Complex Event; expand row to view variants  De novoframeshift insertionNM_022552
NM_175629
NM_175630
NM_022552
NM_175629
NM_175630
c.401dupA
c.401dupA
c.401dupA
c.400dupA
c.400dupA
c.400dupA
p.N134fs
p.N134fs
p.N134fs
p.N134fs
p.N134fs
p.N134fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
Zhou2022 GE
DNMT3A     AU3760301chr2:
25469901-25469901
TAintronicDe novo--Trost2022 G
Yuen2017 G
DNMT3A     Yamamoto2019:7chr2:
25469088-25469089
GGGexonicDe novoframeshift deletionNM_153759
NM_022552
NM_175629
c.802delC
c.1369delC
c.1369delC
p.P268fs
p.P457fs
p.P457fs
--Yamamoto2019 T
DNMT3A     SP0025576chr2:
25464487-25464487
GAexonicDe novononsynonymous SNVNM_153759
NM_022552
NM_175629
c.C1459T
c.C2026T
c.C2026T
p.R487W
p.R676W
p.R676W
27.5-Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
DNMT3A     SP0206343chr2:
25463289-25463289
TGexonicnonsynonymous SNVNM_153759
NM_022552
NM_175629
c.A1637C
c.A2204C
c.A2204C
p.Y546S
p.Y735S
p.Y735S
24.71.687E-5Zhou2022 GE
DNMT3A     SP0224521chr2:
25457176-25457176
GAexonicDe novononsynonymous SNVNM_153759
NM_022552
NM_175629
c.C2144T
c.C2711T
c.C2711T
p.P715L
p.P904L
p.P904L
19.879.067E-5Trost2022 G
Zhou2022 GE
DNMT3A     2-1195-003chr2:
25547340-25547340
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
DNMT3A     SP0026933chr2:
25463566-25463566
CTexonicDe novononsynonymous SNVNM_153759
NM_022552
NM_175629
c.G1549A
c.G2116A
c.G2116A
p.G517R
p.G706R
p.G706R
32.0-Feliciano2019 E
Trost2022 G
Zhou2022 GE
DNMT3A     SP0161350chr2:
25471061-25471061
CCGexonicframeshift insertionNM_153759
NM_022552
NM_175629
c.132dupC
c.699dupC
c.699dupC
p.G45fs
p.G234fs
p.G234fs
--Zhou2022 GE
DNMT3A     SP0353750chr2:
25466784-25466784
AGexonicnonsynonymous SNVNM_153759
NM_022552
NM_175629
c.T1352C
c.T1919C
c.T1919C
p.F451S
p.F640S
p.F640S
27.1-Zhou2022 GE
DNMT3A     SP0139782chr2:
25464463-25464463
CTexonicDe novononsynonymous SNVNM_153759
NM_022552
NM_175629
c.G1483A
c.G2050A
c.G2050A
p.V495I
p.V684I
p.V684I
34.08.262E-6Trost2022 G
Zhou2022 GE
DNMT3A     SP0131505chr2:
25467208-25467208
CTsplicingsplicing21.9-Zhou2022 GE
DNMT3A     SP0308456chr2:
25466799-25466799
CAexonicnonsynonymous SNVNM_153759
NM_022552
NM_175629
c.G1337T
c.G1904T
c.G1904T
p.R446L
p.R635L
p.R635L
34.0-Zhou2022 GE
DNMT3A     11725-1chr2:
25466799-25466799
CTexonicDe novononsynonymous SNVNM_153759
NM_022552
NM_175629
c.G1337A
c.G1904A
c.G1904A
p.R446Q
p.R635Q
p.R635Q
36.04.764E-5Fu2022 E
DNMT3A     80001100770chr2:
25457231-25457231
GAexonicDe novostopgainNM_153759
NM_022552
NM_175629
c.C2089T
c.C2656T
c.C2656T
p.Q697X
p.Q886X
p.Q886X
40.01.649E-5Fu2022 E
DNMT3A     G01-GEA-317-HIchr2:
25463568-25463568
AGexonicDe novononsynonymous SNVNM_153759
NM_022552
NM_175629
c.T1547C
c.T2114C
c.T2114C
p.I516T
p.I705T
p.I705T
25.5-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
DNMT3A     36106chr2:
25457176-25457176
GAexonicDe novononsynonymous SNVNM_153759
NM_022552
NM_175629
c.C2144T
c.C2711T
c.C2711T
p.P715L
p.P904L
p.P904L
19.879.067E-5Fu2022 E
Trost2022 G
DNMT3A     09C99826chr2:
25466800-25466800
GAexonicDe novononsynonymous SNVNM_153759
NM_022552
NM_175629
c.C1336T
c.C1903T
c.C1903T
p.R446W
p.R635W
p.R635W
28.09.526E-5Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
DNMT3A     20572-32334chr2:
25462044-25462044
GAexonicnonsynonymous SNVNM_153759
NM_022552
NM_175629
c.C1796T
c.C2363T
c.C2363T
p.A599V
p.A788V
p.A788V
28.7-Callaghan2019 G
DNMT3A     AU4283301chr2:
25573305-25573305
TCintergenicDe novo--Yuen2017 G
DNMT3A     2-1180-003chr2:
25476100-25476100
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More