or
or
Exact

Results for "CACNA2D4"

Variant Events: 35

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CACNA2D4     iHART2671chr12:
1994049-1994049
TCsplicingMaternalsplicing19.62-Ruzzo2019 G
CACNA2D4     AU1933302chr12:
2031983-2031983
CTintergenicDe novo--Yuen2017 G
CACNA2D4     Shi2013:2chr12:
1967743-1967743
CTexonicInheritednonsynonymous SNVNM_172364c.G2008Ap.G670S26.89.152E-5Shi2013 G
CACNA2D4     AU4159301chr12:
1943157-1943157
GAintronicDe novo--Trost2022 G
Trost2022 G
Yuen2017 G
CACNA2D4     Shi2013:1chr12:
1967743-1967743
CTexonicInheritednonsynonymous SNVNM_172364c.G2008Ap.G670S26.89.152E-5Shi2013 G
CACNA2D4     AU4433301chr12:
1965532-1965532
TGintronicDe novo--Trost2022 G
Yuen2017 G
CACNA2D4     2-0145-003chr12:
1998214-1998214
AGintronicDe novo--Trost2022 G
Yuen2017 G
CACNA2D4     2-0223-004chr12:
1960326-1960326
GAintronicDe novo--Trost2022 G
Yuen2017 G
CACNA2D4     528666869449-Cchr12:
1937493-1937493
CTintronicDe novo--Fu2022 E
CACNA2D4     SP0017223chr12:
1909227-1909227
CTintronicDe novo--Fu2022 E
Trost2022 G
CACNA2D4     SP0014443chr12:
2016610-2016610
AGexonicDe novosynonymous SNVNM_172364c.T777Cp.Y259Y-8.406E-6Fu2022 E
Trost2022 G
Zhou2022 GE
CACNA2D4     SP0046573chr12:
2022173-2022173
CGintronicDe novo--Fu2022 E
CACNA2D4     SP0127239chr12:
1992199-1992199
GGCAGGGCTTCCCTGGGAACCCCTCGCintronicDe novo--Fu2022 E
CACNA2D4     AU1933302chr12:
1994049-1994049
TCsplicingMaternalsplicing19.62-Cirnigliaro2023 G
CACNA2D4     929_15auchr12:
1920881-1920881
CTexonicDe novononsynonymous SNVNM_172364c.G2560Ap.V854I0.0694.403E-5Fu2022 E
CACNA2D4     mAGRE4717chr12:
1906637-1906637
GCexonicMaternalstopgainNM_172364c.C3060Gp.Y1020X36.0-Cirnigliaro2023 G
CACNA2D4     2-1384-003chr12:
1918479-1918479
GAintronicDe novo--Trost2022 G
Yuen2017 G
CACNA2D4     Viggiano2022:22.3chr12:
1995390-1995390
GAexonicPaternalnonsynonymous SNVNM_172364c.C992Tp.A331V32.0-Viggiano2022 GT
CACNA2D4     1-0616-003chr12:
1981809-1981809
GAintronicDe novo--Trost2022 G
CACNA2D4     Viggiano2022:99.4chr12:
1984464-1984464
TCexonicMaternalnonsynonymous SNVNM_172364c.A1759Gp.N587D29.82.484E-5Viggiano2022 GT
CACNA2D4     REACH000767chr12:
2003544-2003544
CTintronicDe novo--Trost2022 G
CACNA2D4     Viggiano2022:60.3chr12:
2022191-2022191
GAexonicPaternalstopgainNM_172364c.C424Tp.Q142X18.28.643E-6Viggiano2022 GT
CACNA2D4     3-0402-000chr12:
1937974-1937974
TAintronicDe novo--Trost2022 G
Trost2022 G
CACNA2D4     AU056804chr12:
2026540-2026540
CTintronicDe novo--Trost2022 G
Yuen2017 G
CACNA2D4     Viggiano2022:22.4chr12:
1995390-1995390
GAexonicPaternalnonsynonymous SNVNM_172364c.C992Tp.A331V32.0-Viggiano2022 GT
CACNA2D4     AU011704chr12:
1980675-1980675
GGGTintronicDe novo--Trost2022 G
CACNA2D4     Viggiano2022:22.3chr12:
1902919-1902919
CTexonicPaternalnonsynonymous SNVNM_172364c.G3316Ap.A1106T26.9-Viggiano2022 GT
CACNA2D4     1-0059-003Achr12:
1913230-1913230
TCintronicDe novo--Trost2022 G
CACNA2D4     SP0117834chr12:
1967735-1967735
CTintronicDe novo--Fu2022 E
Trost2022 G
Zhou2022 GE
CACNA2D4     MSSNG00415-003chr12:
1936882-1936882
CTintronicDe novo--Trost2022 G
Trost2022 G
CACNA2D4     Viggiano2022:12.5chr12:
1963193-1963193
GAexonicPaternalnonsynonymous SNVNM_172364c.C2170Tp.R724W28.02.0E-4Viggiano2022 GT
CACNA2D4     Viggiano2022:22.4chr12:
1902919-1902919
CTexonicPaternalnonsynonymous SNVNM_172364c.G3316Ap.A1106T26.9-Viggiano2022 GT
CACNA2D4     14632.p1chr12:
1989039-1989039
GCexonicnonsynonymous SNVNM_172364c.C1494Gp.S498R2.168-Zhou2022 GE
CACNA2D4     SP0151767chr12:
1904579-1904579
ACintronicDe novo--Trost2022 G
CACNA2D4     1-0059-003chr12:
1913230-1913230
TCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More