or
or
Exact

Results for "MUC6"

Variant Events: 25

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MUC6     SP0048064chr11:
1020674-1020674
GAintronicDe novo-4.982E-5Fu2022 E
Trost2022 G
MUC6     SP0101325chr11:
1031856-1031856
CTexonicDe novononsynonymous SNVNM_005961c.G313Ap.V105I6.8693.0E-4Fu2022 E
Trost2022 G
MUC6     2-1093-009chr11:
1041507-1041507
TCintergenicDe novo--Yuen2017 G
MUC6     AU063005chr11:
1052255-1052255
GAintergenicDe novo--Yuen2017 G
MUC6     Shi2013:2chr11:
1018095-1018095
GTAexonicInheritedframeshift substitutionNM_005961c.4706_4706delinsTAN/A--Shi2013 G
MUC6     DEASD_0330_001chr11:
1016042-1016042
CGexonicDe novononsynonymous SNVNM_005961c.G6759Cp.R2253S3.197-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
MUC6     TAS_F3012Ychr11:
1026085-1026085
CTexonicDe novononsynonymous SNVNM_005961c.G2603Ap.C868Y14.0-Fu2022 E
Satterstrom2020 E
Trost2022 G
MUC6     iHART2999chr11:
1018737-1018738
GTGexonicPaternalframeshift deletionNM_005961c.4063delAp.T1355fs--Ruzzo2019 G
MUC6     Wang2023:519chr11:
1016003-1016006
AGAGAexonicDe novononframeshift deletionNM_005961c.6795_6797delp.2265_2266del--Wang2023 E
MUC6     iHART1581chr11:
1015767-1015767
GCexonicPaternalstopgainNM_005961c.C7034Gp.S2345X46.09.19E-6Ruzzo2019 G
MUC6     Shi2013:1chr11:
1018095-1018095
GTAexonicInheritedframeshift substitutionNM_005961c.4706_4706delinsTAN/A--Shi2013 G
MUC6     iHART2888chr11:
1028888-1028888
CTsplicingPaternalsplicing14.053.338E-5Ruzzo2019 G
MUC6     11957.p1chr11:
1027790-1027790
CTexonicDe novononsynonymous SNVNM_005961c.G1876Ap.E626K14.113.975E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
MUC6     SSC04242chr11:
1027790-1027790
CTexonicDe novononsynonymous SNVNM_005961c.G1876Ap.E626K14.113.975E-5Fu2022 E
Lim2017 E
Trost2022 G
MUC6     13660.p1chr11:
1016288-1016288
GCexonicMosaicnonsynonymous SNVNM_005961c.C6513Gp.H2171Q8.562-Dou2017 E
MUC6     1-0511-003chr11:
1049422-1049446
AATGATGATGATGATGATGATGATGAATGATGATGATGATGATGATGintergenicDe novo--Yuen2017 G
MUC6     ASC_18D972chr11:
1025236-1025236
CTexonicDe novosynonymous SNVNM_005961c.G2931Ap.T977T-1.671E-5Fu2022 E
MUC6     1-0291-003chr11:
1026978-1026978
GAexonicDe novononsynonymous SNVNM_005961c.C2357Tp.A786V15.226.41E-5Trost2022 G
MUC6     7-0351-004chr11:
1028216-1028216
GAintronicDe novo--Trost2022 G
MUC6     AU2792302chr11:
1029555-1029557
CAGCexonicPaternalframeshift deletionNM_005961c.1074_1075delp.P358fs-2.0E-4Cirnigliaro2023 G
MUC6     mAGRE2888chr11:
1028888-1028888
CTsplicingPaternalsplicing14.053.338E-5Cirnigliaro2023 G
MUC6     REACH000529chr11:
1015786-1015786
CTexonicDe novononsynonymous SNVNM_005961c.G7015Ap.G2339R8.4072.0E-4Trost2022 G
MUC6     mAGRE2999chr11:
1018737-1018738
GTGexonicPaternalframeshift deletionNM_005961c.4063delAp.T1355fs--Cirnigliaro2023 G
MUC6     F10276-1chr11:
1013542-1013542
CTexonicDe novononsynonymous SNVNM_005961c.G7234Ap.D2412N10.261.0E-4Fu2022 E
MUC6     mAGRE1581chr11:
1015767-1015767
GCexonicPaternalstopgainNM_005961c.C7034Gp.S2345X46.09.19E-6Cirnigliaro2023 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More