or
or
Exact

Results for "ZNF717"

Variant Events: 99

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ZNF717     MCD-033-4chr3:
75786041-75786042
AGAexonicMaternalframeshift deletionNM_001128223
NM_001290208
NM_001290209
c.2732delC
c.2732delC
c.2582delC
p.S911fs
p.S911fs
p.S861fs
--Tuncay2023 G
ZNF717     MCD-033-4chr3:
75786036-75786036
AGexonicMaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.T2738C
c.T2738C
c.T2588C
p.F913S
p.F913S
p.F863S
9.28-Tuncay2023 G
ZNF717     7-0151-003chr3:
76029301-76029301
CTintergenicDe novo--Yuen2017 G
ZNF717     MCD-033-3chr3:
75788245-75788245
CTexonicMaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.G529A
c.G529A
c.G379A
p.G177R
p.G177R
p.G127R
16.81-Tuncay2023 G
ZNF717     AU2248302chr3:
76262614-76262614
GAintergenicDe novo--Yuen2017 G
ZNF717     AU2248302chr3:
76397895-76397895
AGintergenicDe novo--Yuen2017 G
ZNF717     Shi2013:1chr3:
75788152-75788152
TGCexonicInheritedframeshift substitutionNM_001128223
NM_001290208
NM_001290209
c.622_622delinsGC
c.622_622delinsGC
c.472_472delinsGC
N/A
N/A
N/A
--Shi2013 G
ZNF717     2-0306-004chr3:
76114440-76114440
GTintergenicDe novo--Yuen2017 G
ZNF717     AU060004chr3:
76235490-76235490
AGintergenicDe novo--Yuen2017 G
ZNF717     MCD-033-4chr3:
75788245-75788245
CTexonicMaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.G529A
c.G529A
c.G379A
p.G177R
p.G177R
p.G127R
16.81-Tuncay2023 G
ZNF717     2-0012-004chr3:
76505951-76505951
GTintergenicDe novo--Yuen2017 G
ZNF717     2-1384-003chr3:
76809763-76809763
CGintergenicDe novo--Yuen2017 G
ZNF717     MCD-033-4 Complex Event; expand row to view variants  Maternalframeshift insertion, nonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
NM_001128223
NM_001290208
NM_001290209
c.C1421T
c.C1421T
c.C1271T
c.1421_1422insT
c.1421_1422insT
c.1271_1272insT
p.T474I
p.T474I
p.T424I
p.T474fs
p.T474fs
p.T424fs
14.68-Tuncay2023 G
Tuncay2023 G
ZNF717     2-1322-004chr3:
76402614-76402614
TCintergenicDe novo--Yuen2017 G
ZNF717     3729_17auchr3:
75790895-75790895
GGATAGCAGGCTGTTATAAGTCTCCAGCATCACATCCCTGTACAGGGTCCTCTGAGCATTATCCAGGTCCTGCCACTCCTCCCAGGTGAAGTGCACAGCAACATCTTCAAAAGATATCAACCCCTGTAATGGCATATTTTTCCTCintronicDe novo--Fu2022 E
ZNF717     1-0075-003chr3:
75968920-75968920
CTintergenicDe novo--Yuen2017 G
ZNF717     AU1355301chr3:
75896158-75896158
CTintergenicDe novo--Yuen2017 G
ZNF717     5-0138-003chr3:
76548726-76548726
CTintergenicDe novo--Yuen2017 G
ZNF717     2-0306-003chr3:
76114440-76114440
GTintergenicDe novo--Yuen2016 G
ZNF717     AU3907301chr3:
75810570-75810570
TAintronicDe novo--Trost2022 G
ZNF717     5-0023-003chr3:
75819830-75819830
CTintronicDe novo--Trost2022 G
ZNF717     2-1279-003chr3:
76479036-76479036
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
ZNF717     MSSNG00412-003chr3:
75828819-75828819
ACintronicDe novo--Trost2022 G
ZNF717     SSC03607chr3:
75788375-75788375
TCexonicDe novosynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.A399G
c.A399G
c.A249G
p.T133T
p.T133T
p.T83T
--Fu2022 E
ZNF717     Shi2013:2chr3:
75788152-75788152
TGCexonicInheritedframeshift substitutionNM_001128223
NM_001290208
NM_001290209
c.622_622delinsGC
c.622_622delinsGC
c.472_472delinsGC
N/A
N/A
N/A
--Shi2013 G
ZNF717     12071.p1chr3:
75788375-75788375
TCexonicsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.A399G
c.A399G
c.A249G
p.T133T
p.T133T
p.T83T
--Zhou2022 GE
ZNF717     AU079605chr3:
75787051-75787051
TCexonicnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.A1723G
c.A1723G
c.A1573G
p.K575E
p.K575E
p.K525E
10.24-Zhou2022 GE
ZNF717     AU2951302chr3:
76630165-76630171
GTGGTTGGTGintergenicDe novo--Yuen2017 G
ZNF717     1-0175-004chr3:
76091779-76091779
AGintergenicDe novo--Yuen2017 G
ZNF717     AU3716302chr3:
76697827-76697827
GAintergenicDe novo--Yuen2017 G
ZNF717     AU056804chr3:
76471235-76471239
CAGAGCAGintergenicDe novo--Yuen2017 G
ZNF717     1-0526-003chr3:
76825405-76825405
ATintergenicDe novo--Yuen2017 G
ZNF717     AU3861303chr3:
76649319-76649319
TCintergenicDe novo--Yuen2017 G
ZNF717     2-0171-003chr3:
76628581-76628581
CTintergenicDe novo--Yuen2017 G
ZNF717     1-0274-004chr3:
76900923-76900925
CATCintergenicDe novo--Yuen2017 G
ZNF717     AU3605304chr3:
76755358-76755358
TGintergenicDe novo--Yuen2017 G
ZNF717     AU3368302chr3:
76296726-76296730
ATTTTATTTTTintergenicDe novo--Yuen2017 G
ZNF717     AU4092302chr3:
76980424-76980424
AGintergenicDe novo--Yuen2017 G
ZNF717     2-1508-003chr3:
76025828-76025828
AGintergenicDe novo--Yuen2017 G
ZNF717     2-1169-003chr3:
76638418-76638418
AGintergenicDe novo--Yuen2017 G
ZNF717     AU0452304chr3:
75988030-75988030
GTintergenicDe novo--Yuen2017 G
ZNF717     MCD-033-3chr3:
75786518-75786518
ACexonicPaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.T2256G
c.T2256G
c.T2106G
p.H752Q
p.H752Q
p.H702Q
14.69-Tuncay2023 G
ZNF717     MCD-033-3chr3:
75786501-75786501
TAexonicPaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.A2273T
c.A2273T
c.A2123T
p.Y758F
p.Y758F
p.Y708F
6.645-Tuncay2023 G
ZNF717     5-0074-003chr3:
76082965-76082965
GAintergenicDe novo--Yuen2017 G
ZNF717     MCD-033-3chr3:
75787726-75787726
GAexonicPaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.C1048T
c.C1048T
c.C898T
p.R350C
p.R350C
p.R300C
9.535-Tuncay2023 G
ZNF717     AU043804chr3:
76042336-76042336
GAintergenicDe novo--Yuen2017 G
ZNF717     MCD-033-3chr3:
75786827-75786827
ATexonicPaternalstopgainNM_001128223
NM_001290208
NM_001290209
c.T1947A
c.T1947A
c.T1797A
p.C649X
p.C649X
p.C599X
37.0-Tuncay2023 G
ZNF717     A6chr3:
77042112-77042112
GAintergenicDe novo--Wu2018 G
ZNF717     2-0264-004chr3:
76242832-76242832
GCintergenicDe novo--Yuen2017 G
ZNF717     MCD-033-3chr3:
75786278-75786278
ACexonicPaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.T2496G
c.T2496G
c.T2346G
p.H832Q
p.H832Q
p.H782Q
9.956-Tuncay2023 G
ZNF717     MCD-033-3chr3:
75786261-75786261
CTexonicPaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.G2513A
c.G2513A
c.G2363A
p.G838E
p.G838E
p.G788E
14.84-Tuncay2023 G
ZNF717     MCD-033-3chr3:
75786490-75786490
CGexonicPaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.G2284C
c.G2284C
c.G2134C
p.E762Q
p.E762Q
p.E712Q
0.022-Tuncay2023 G
ZNF717     MCD-033-3chr3:
75786417-75786417
TCexonicPaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.A2357G
c.A2357G
c.A2207G
p.Y786C
p.Y786C
p.Y736C
13.34-Tuncay2023 G
ZNF717     2-1264-003chr3:
76521095-76521095
AGintergenicDe novo--Yuen2017 G
ZNF717     MCD-033-4chr3:
75786243-75786243
CTexonicPaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.G2531A
c.G2531A
c.G2381A
p.C844Y
p.C844Y
p.C794Y
13.4-Tuncay2023 G
ZNF717     SP0040244chr3:
76483929-76483929
CTintergenicDe novo--Fu2022 E
ZNF717     MCD-033-4chr3:
75786261-75786261
CTexonicPaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.G2513A
c.G2513A
c.G2363A
p.G838E
p.G838E
p.G788E
14.84-Tuncay2023 G
ZNF717     MCD-033-4chr3:
75786256-75786256
TAexonicPaternalstopgainNM_001128223
NM_001290208
NM_001290209
c.A2518T
c.A2518T
c.A2368T
p.K840X
p.K840X
p.K790X
37.0-Tuncay2023 G
ZNF717     MCD-033-4chr3:
75787726-75787726
GAexonicPaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.C1048T
c.C1048T
c.C898T
p.R350C
p.R350C
p.R300C
9.535-Tuncay2023 G
ZNF717     MCD-033-4chr3:
75786501-75786501
TAexonicPaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.A2273T
c.A2273T
c.A2123T
p.Y758F
p.Y758F
p.Y708F
6.645-Tuncay2023 G
ZNF717     AU1668302chr3:
76147409-76147409
CAintergenicDe novo--Yuen2017 G
ZNF717     MCD-033-4chr3:
75790836-75790838
GCCGexonicPaternalframeshift deletionNM_001128223
NM_001290208
NM_001290210
c.107_108del
c.107_108del
c.107_108del
p.W36fs
p.W36fs
p.W36fs
--Tuncay2023 G
ZNF717     MCD-033-4chr3:
75790791-75790791
GCexonicPaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
NM_001290210
c.C154G
c.C154G
c.C4G
c.C154G
p.L52V
p.L52V
p.L2V
p.L52V
12.62-Tuncay2023 G
ZNF717     MCD-033-4chr3:
75786288-75786288
AGexonicPaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.T2486C
c.T2486C
c.T2336C
p.L829P
p.L829P
p.L779P
12.68-Tuncay2023 G
ZNF717     MCD-033-4chr3:
75786278-75786278
ACexonicPaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.T2496G
c.T2496G
c.T2346G
p.H832Q
p.H832Q
p.H782Q
9.956-Tuncay2023 G
ZNF717     MCD-033-4chr3:
75786490-75786490
CGexonicPaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.G2284C
c.G2284C
c.G2134C
p.E762Q
p.E762Q
p.E712Q
0.022-Tuncay2023 G
ZNF717     AU046706chr3:
76357960-76357960
GCintergenicDe novo--Yuen2017 G
ZNF717     MCD-033-4chr3:
75786337-75786337
GAexonicPaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.C2437T
c.C2437T
c.C2287T
p.P813S
p.P813S
p.P763S
13.09-Tuncay2023 G
ZNF717     AU075703chr3:
75862154-75862154
AGintergenicDe novo--Yuen2017 G
ZNF717     1-0452-003chr3:
76004958-76004958
CAintergenicDe novo--Yuen2016 G
ZNF717     1-0508-003chr3:
75809885-75809885
CTintronicDe novo--Trost2022 G
Yuen2017 G
ZNF717     2-1276-003chr3:
75895412-75895412
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
ZNF717     2-1302-003chr3:
76181819-76181819
CTintergenicDe novo--Yuen2017 G
ZNF717     AU4069301chr3:
76006663-76006663
GAintergenicDe novo--Yuen2017 G
ZNF717     AU3646301chr3:
76813877-76813877
CTintergenicDe novo--Yuen2017 G
ZNF717     7-0100-003chr3:
76754066-76754066
AGintergenicDe novo--Yuen2017 G
ZNF717     AU058103chr3:
76940790-76940790
TCintergenicDe novo--Yuen2017 G
ZNF717     2-1696-003chr3:
75892270-75892270
GCintergenicDe novo--Yuen2017 G
ZNF717     2-0214-004chr3:
76014575-76014575
AGintergenicDe novo--Yuen2017 G
ZNF717     AU4263304chr3:
76592659-76592659
GCintergenicDe novo--Yuen2017 G
ZNF717     2-0272-004chr3:
76707524-76707524
CTintergenicDe novo--Yuen2017 G
ZNF717     2-1169-004chr3:
76499191-76499191
GTintergenicDe novo--Yuen2017 G
ZNF717     5-0077-003chr3:
76014567-76014567
CAintergenicDe novo--Yuen2017 G
ZNF717     AU2951303chr3:
76630165-76630171
GTGGTTGGTGintergenicDe novo--Yuen2017 G
ZNF717     1-0669-003chr3:
76895509-76895514
TATGATTATintergenicDe novo--Yuen2017 G
ZNF717     1-0826-004chr3:
76599896-76599902
GCCAAACGintergenicDe novo--Yuen2017 G
ZNF717     AU2458302chr3:
76385780-76385782
CTTCTintergenicDe novo--Yuen2017 G
ZNF717     1-0253-004chr3:
76127804-76127804
CTintergenicDe novo--Yuen2017 G
ZNF717     AU1635302chr3:
76086088-76086088
CTintergenicDe novo--Yuen2017 G
ZNF717     1-0175-003chr3:
76091779-76091779
AGintergenicDe novo--Yuen2017 G
ZNF717     AU4219302chr3:
76434398-76434398
CTintergenicDe novo--Yuen2017 G
ZNF717     AU3885305chr3:
76212298-76212298
GTintergenicDe novo--Yuen2017 G
ZNF717     MCD-032-4chr3:
75787519-75787519
CAexonicMaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.G1255T
c.G1255T
c.G1105T
p.G419W
p.G419W
p.G369W
13.76-Tuncay2023 G
ZNF717     1-0965-003chr3:
76838812-76838812
GCintergenicDe novo--Yuen2017 G
ZNF717     MCD-032-4chr3:
75787516-75787516
CGexonicMaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.G1258C
c.G1258C
c.G1108C
p.E420Q
p.E420Q
p.E370Q
16.14-Tuncay2023 G
ZNF717     2-1148-004chr3:
76076647-76076647
AGintergenicDe novo--Yuen2017 G
ZNF717     AU4234302chr3:
76333341-76333341
GAintergenicDe novo--Yuen2017 G
ZNF717     MCD-033-3chr3:
75787353-75787353
GAexonicMaternalnonsynonymous SNVNM_001128223
NM_001290208
NM_001290209
c.C1421T
c.C1421T
c.C1271T
p.T474I
p.T474I
p.T424I
14.68-Tuncay2023 G
ZNF717     AU0540301chr3:
76649812-76649812
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More