or
or
Exact

Results for "CD6"

Variant Events: 17

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CD6     2-1322-003chr11:
60774107-60774107
GGTexonicDe novoframeshift insertionNM_001254750
NM_001254751
NM_006725
c.111_112insT
c.111_112insT
c.111_112insT
p.W37fs
p.W37fs
p.W37fs
--Trost2022 G
Zhou2022 GE
CD6     AU070007chr11:
60861709-60861709
GAintergenicDe novo--Trost2022 G
Yuen2017 G
CD6     AU4159301chr11:
60777541-60777541
AGintronicDe novo--Trost2022 G
Yuen2017 G
CD6     3986_16auchr11:
60777364-60777364
AACintronicDe novo-5.0E-4Fu2022 E
CD6     11420.p1chr11:
60851085-60851085
GAintergenicDe novo--Werling2018 G
CD6     1-1167-003chr11:
60786713-60786713
TCintronicDe novo--Trost2022 G
CD6     2-1308-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CD6     2-1456-004chr11:
60849387-60849387
CTintergenicDe novo--Yuen2017 G
CD6     2-1549-003chr11:
60835851-60835868
ATCTCTCTCTCTCTCTCTATCTCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
CD6     AU2023302chr11:
60825857-60825857
GAintergenicDe novo--Yuen2017 G
CD6     REACH000431chr11:
60750569-60750569
TCintronicDe novo--Trost2022 G
CD6     2-1428-003chr11:
60782913-60782913
CAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CD6     SP0141122chr11:
60776348-60776348
AGintronicDe novo--Fu2022 E
CD6     2-1166-003chr11:
60868544-60868548
ATTCGAintergenicDe novo--Yuen2017 G
CD6     AU3858303 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
Trost2022 G
Yuen2017 G
Yuen2017 G
CD6     2-1380-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CD6     AU4473301chr11:
60762839-60762850
ACTCCCGACCTCACTCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More