or
or
Exact

Results for "PLXNA4"

Variant Events: 64

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PLXNA4     Wang2023:212chr7:
131866330-131866330
AGexonicDe novononsynonymous SNVNM_020911c.T3302Cp.L1101P21.0-Wang2023 E
PLXNA4     1-0269-003chr7:
132320233-132320233
AGintronicDe novo--Trost2022 G
Yuen2017 G
PLXNA4     1-0153-004chr7:
132239281-132239281
GAintronicDe novo--Yuen2017 G
PLXNA4     1-0971-003chr7:
132151537-132151537
TAintronicDe novo--Trost2022 G
Yuen2017 G
PLXNA4     4-0100-004chr7:
131899487-131899487
CTintronicDe novo--Trost2022 G
PLXNA4     1-1183-003chr7:
131906574-131906574
ATintronicDe novo--Trost2022 G
PLXNA4     1-0853-003chr7:
131876314-131876314
GAintronicDe novo--Trost2022 G
PLXNA4     2-0323-004chr7:
131890629-131890629
CAAintronicDe novo--Trost2022 G
PLXNA4     2-1416-003Achr7:
131811299-131811299
GGGCGCUTR3De novo--Trost2022 G
PLXNA4     AU1860301chr7:
131820824-131820824
AGintronicDe novo--Trost2022 G
Yuen2017 G
PLXNA4     2-1416-003Achr7:
131811302-131811303
ATGTAUTR3De novo--Trost2022 G
PLXNA4     2-1511-003chr7:
132314970-132314970
AGintronicDe novo--Trost2022 G
Yuen2017 G
PLXNA4     AU070703chr7:
132323997-132323997
CAintronicDe novo--Yuen2017 G
PLXNA4     3-0661-000chr7:
131918977-131918977
TGintronicDe novo--Trost2022 G
Yuen2017 G
PLXNA4     MSSNG00103-004chr7:
131807807-131807807
GAdownstreamDe novo--Trost2022 G
PLXNA4     3-0339-000chr7:
131825553-131825553
CGexonicDe novononsynonymous SNVNM_020911c.G5243Cp.W1748S24.7-Trost2022 G
Zhou2022 GE
PLXNA4     MSSNG00041-003chr7:
132078258-132078258
TCintronicDe novo--Trost2022 G
PLXNA4     4-0062-003chr7:
132086141-132086142
GTAAintronicDe novo--Trost2022 G
PLXNA4     2-1097-003chr7:
132018328-132018339
CCTGCTCCTCAGCintronicDe novo--Trost2022 G
PLXNA4     AU024607chr7:
131846092-131846092
GAintronicDe novo--Trost2022 G
Yuen2017 G
PLXNA4     2-1467-003chr7:
132055886-132055886
CAintronicDe novo--Trost2022 G
PLXNA4     7-0390-003chr7:
131972556-131972556
CTintronicDe novo--Trost2022 G
PLXNA4     REACH000701chr7:
132011882-132011882
AGintronicDe novo--Trost2022 G
PLXNA4     08C77057chr7:
131878889-131878889
CTexonicDe novononsynonymous SNVNM_020911c.G2788Ap.V930M26.84.157E-5Fu2022 E
PLXNA4     1-0944-003chr7:
131909789-131909789
GAintronicDe novo--Trost2022 G
PLXNA4     MSSNG00019-003Achr7:
131969077-131969077
TTAintronicDe novo--Trost2022 G
PLXNA4     MSSNG00394-003chr7:
132233095-132233095
GCintronicDe novo--Trost2022 G
PLXNA4     1-0153-004Achr7:
132239281-132239281
GAintronicDe novo--Trost2022 G
PLXNA4     AUTPGX_1020chr7:
132223187-132223187
GAintronicDe novo--Trost2022 G
PLXNA4     11726.p1chr7:
132094142-132094142
CGintronicDe novo--Werling2018 G
PLXNA4     AU2193301chr7:
132233085-132233085
GAintronicDe novo--Trost2022 G
PLXNA4     AU2308301chr7:
132142929-132142929
TCintronicDe novo--Trost2022 G
PLXNA4     2-0320-003chr7:
132262538-132262538
CTintronicDe novo--Trost2022 G
Yuen2017 G
PLXNA4     2-1339-003chr7:
132292557-132292557
AACTATCACCATCACTGCCATCATCCintronicDe novo--Yuen2017 G
PLXNA4     5-5064-003chr7:
132197617-132197617
CTintronicDe novo--Trost2022 G
PLXNA4     1-0218-003chr7:
132272616-132272616
ACintronicDe novo--Trost2022 G
Yuen2017 G
PLXNA4     4-0073-003chr7:
132086141-132086142
GTAAintronicDe novo--Trost2022 G
PLXNA4     10-0005-003chr7:
132095068-132095076
ATCTGAGCTAintronicDe novo--Trost2022 G
PLXNA4     1-1134-004chr7:
132329744-132329744
TCintronicDe novo--Trost2022 G
PLXNA4     REACH000476chr7:
132330041-132330041
GAintronicDe novo--Trost2022 G
PLXNA4     5-5130-003chr7:
132284126-132284126
TCintronicDe novo--Trost2022 G
PLXNA4     MSSNG00249-003chr7:
132314927-132314927
GAintronicDe novo--Trost2022 G
PLXNA4     4-0062-003chr7:
132241904-132241904
ATTintronicDe novo--Trost2022 G
PLXNA4     3-0229-000chr7:
132258743-132258743
AGintronicDe novo--Trost2022 G
PLXNA4     2-1456-004chr7:
132250395-132250395
GAintronicDe novo--Trost2022 G
Yuen2017 G
PLXNA4     1-0559-003chr7:
131981346-131981346
CTintronicDe novo--Trost2022 G
Yuen2017 G
PLXNA4     2-1417-003chr7:
131849252-131849252
GTintronicDe novo--Trost2022 G
Yuen2017 G
PLXNA4     2-1255-003chr7:
131880391-131880397
GAAAAAAGAAAAAintronicDe novo--Yuen2017 G
PLXNA4     1-0257-003chr7:
131980419-131980419
GAintronicDe novo--Trost2022 G
Yuen2017 G
PLXNA4     12636.p1chr7:
131825445-131825445
GAexonicMosaicnonsynonymous SNVNM_020911c.C5351Tp.T1784M25.28.237E-6Krupp2017 E
PLXNA4     1-0323-003chr7:
132183915-132183915
ACintronicDe novo--Trost2022 G
Yuen2017 G
PLXNA4     1-0496-003chr7:
132321577-132321577
TCintronicDe novo--Yuen2016 G
Yuen2017 G
PLXNA4     AU3451301chr7:
132315118-132315118
CAintronicDe novo--Yuen2017 G
PLXNA4     AU3124302chr7:
132249967-132249967
GAintronicDe novo--Trost2022 G
Yuen2017 G
PLXNA4     2-1137-003chr7:
131958101-131958116
GCACACACACACACACGCACACACACACACintronicDe novo--Yuen2017 G
PLXNA4     AU069603chr7:
131917599-131917599
GAintronicDe novo--Trost2022 G
Yuen2017 G
PLXNA4     1-0099-003chr7:
131928988-131928988
CTintronicDe novo--Trost2022 G
Yuen2017 G
PLXNA4     1-0226-005chr7:
132193311-132193311
CTexonicDe novononsynonymous SNVNM_001105543
NM_020911
NM_181775
c.G142A
c.G142A
c.G142A
p.A48T
p.A48T
p.A48T
0.0084.0E-4Trost2022 G
Yuen2017 G
Zhou2022 GE
PLXNA4     2-1330-003chr7:
132272100-132272100
CAintronicDe novo--Yuen2016 G
PLXNA4     1-0569-003chr7:
132105934-132105934
ACintronicDe novo--Trost2022 G
Yuen2017 G
PLXNA4     SP0079752chr7:
131865565-131865565
CAintronicDe novo--Fu2022 E
Trost2022 G
PLXNA4     SP0018338chr7:
131830065-131830065
GAintronicDe novo--Fu2022 E
Trost2022 G
PLXNA4     5-0065-003chr7:
132172337-132172337
GAintronicDe novo--Trost2022 G
Yuen2017 G
PLXNA4     2-1335-003chr7:
132030801-132030801
ACintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More