or
or
Exact

Results for "USP13"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
USP13     P2M7G_01chr3:
179389593-179389593
TCintronicDe novo--Trost2022 G
USP13     SP0120175chr3:
179448422-179448422
CGexonicDe novosynonymous SNVNM_003940c.C1179Gp.G393G--Fu2022 E
USP13     7-0168-003chr3:
179423081-179423081
GGTTATintronicDe novo--Trost2022 G
USP13     MT_24.3chr3:
179388913-179388913
CTintronicDe novo--Trost2022 G
USP13     mAGRE2630chr3:
179474867-179474867
GAsplicingMaternalsplicing21.51.0E-4Cirnigliaro2023 G
USP13     mAGRE2940chr3:
179426691-179426726
GACATGGGCTACCCACTAGCCGTGAAACTGGGAACCGexonicPaternalframeshift deletionNM_003940c.752_786delp.D251fs--Cirnigliaro2023 G
USP13     iHART2939chr3:
179426691-179426726
GACATGGGCTACCCACTAGCCGTGAAACTGGGAACCGexonicPaternalframeshift deletionNM_003940c.752_786delp.D251fs--Ruzzo2019 G
USP13     1-0844-003chr3:
179494211-179494211
AGintronicDe novo--Trost2022 G
USP13     AU2207301chr3:
179500634-179500634
ACintronicDe novo--Trost2022 G
USP13     iHART2630chr3:
179474867-179474867
GAsplicingMaternalsplicing21.51.0E-4Ruzzo2019 G
USP13     SP0117308chr3:
179463030-179463030
ATintronicDe novo--Trost2022 G
USP13     iHART2940chr3:
179426691-179426726
GACATGGGCTACCCACTAGCCGTGAAACTGGGAACCGexonicPaternalframeshift deletionNM_003940c.752_786delp.D251fs--Ruzzo2019 G
USP13     SP0162628chr3:
179472564-179472564
CTexonicDe novostopgainNM_003940c.C1843Tp.R615X43.02.472E-5Trost2022 G
USP13     2-0139-004chr3:
179460567-179460567
CTintronicDe novo--Trost2022 G
USP13     7-0454-003chr3:
179461839-179461839
TGintronicDe novo--Trost2022 G
USP13     MSSNG00108-003chr3:
179426981-179426981
TCintronicDe novo--Trost2022 G
USP13     MSSNG00390-003chr3:
179447688-179447688
GAintronicDe novo--Trost2022 G
USP13     5-5011-003chr3:
179502245-179502245
CTUTR3De novo--Trost2022 G
USP13     1-0590-003chr3:
179463965-179463981
CTATATATATATATATACTATATATATATATAintronicDe novo--Yuen2017 G
USP13     7-0191-003chr3:
179474382-179474382
TAintronicDe novo--Trost2022 G
Yuen2017 G
USP13     7-0222-003chr3:
179376611-179376611
GAintronicDe novo--Trost2022 G
Yuen2017 G
USP13     AU3903302chr3:
179389283-179389283
CTintronicDe novo--Trost2022 G
Yuen2017 G
USP13     20-0613146-18chr3:
179481758-179481758
GAintronicDe novo-3.047E-5Satterstrom2020 E
Trost2022 G
USP13     1-0636-003chr3:
179379766-179379766
TCintronicDe novo--Trost2022 G
Yuen2017 G
USP13     AU2777302chr3:
179376129-179376129
TCintronicDe novo--Trost2022 G
Yuen2017 G
USP13     AU3724301 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
USP13     13462.p1chr3:
179477821-179477821
CGintronicUnknown--Werling2018 G
USP13     mAGRE2939chr3:
179426691-179426726
GACATGGGCTACCCACTAGCCGTGAAACTGGGAACCGexonicPaternalframeshift deletionNM_003940c.752_786delp.D251fs--Cirnigliaro2023 G
USP13     2-1635-004chr3:
179389051-179389051
CTintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More