or
or
Exact

Results for "KNDC1"

Variant Events: 18

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KNDC1     505-09-112395chr10:
135033618-135033714
TGAGGAGGGGCTCAGGCGGCCGCGCGCCCAGGAGAGGAGGGGCTCAGGCGGGCGCGCGCCCAGGAGAGGAGGGGCTCAGGCGGCCGCGCGCCCAGGATintronicDe novo--Fu2022 E
KNDC1     G01-GEA-31-HIchr10:
135012705-135012705
GAexonicDe novononsynonymous SNVNM_152643c.G2693Ap.R898H15.09-Fu2022 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
KNDC1     AU4007302chr10:
135011184-135011184
CGexonicPaternalstopgainNM_152643c.C1818Gp.Y606X39.08.288E-6Cirnigliaro2023 G
KNDC1     12761.p1chr10:
135027123-135027123
AGintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
KNDC1     SP0052654chr10:
135020788-135020788
GAexonicDe novononsynonymous SNVNM_152643c.G3727Ap.G1243S10.779.399E-5Fu2022 E
Trost2022 G
Zhou2022 GE
KNDC1     7-0457-004chr10:
134998958-134998958
GTintronicDe novo--Trost2022 G
KNDC1     2-1355-003chr10:
135004125-135004125
CTintronicDe novo--Yuen2017 G
KNDC1     MSSNG00347-004chr10:
134998958-134998958
GTintronicDe novo--Trost2022 G
KNDC1     11587.p1chr10:
135039876-135039876
CTUTR3Unknown--Werling2018 G
KNDC1     1-0353-003chr10:
134980016-134980020
ATGTGAintronicDe novo--Yuen2017 G
KNDC1     7-0352-003chr10:
134987816-134987816
GCintronicDe novo--Trost2022 G
KNDC1     2-1185-003 Complex Event; expand row to view variants  De novoframeshift deletionNM_152643
NM_152643
c.4559delC
c.4560delC
p.T1520fs
p.T1520fs
--Trost2022 G
Yuen2017 G
Zhou2022 GE
KNDC1     70328chr10:
135027123-135027123
AGintronicDe novo--Trost2022 G
KNDC1     1-0874-003chr10:
135034309-135034309
GCintronicDe novo--Trost2022 G
KNDC1     4-0004-003chr10:
135013337-135013337
CTintronicDe novo--Trost2022 G
KNDC1     3-0114-000chr10:
135019818-135019818
AGintronicDe novo--Trost2022 G
KNDC1     7-0462-004chr10:
135006115-135006115
AGintronicDe novo--Trost2022 G
KNDC1     SP0184134chr10:
135011796-135011796
GAintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More