or
or
Exact

Results for "PTPRG"

Variant Events: 102

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PTPRG     AU4452302chr3:
61696300-61696300
ATintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     2-1356-003chr3:
62179486-62179486
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PTPRG     1-0507-003chr3:
61727216-61727216
TGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PTPRG     AU3713301chr3:
62176267-62176267
CTintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     1-0294-003chr3:
61728401-61728401
GAintronicDe novo--Yuen2016 G
PTPRG     AU056804chr3:
61938281-61938281
CTintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     1-0744-003chr3:
61933157-61933157
TCintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     5-0055-004chr3:
61861592-61861592
CTintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     2-1283-003chr3:
62193550-62193550
ATintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     AU4476302chr3:
61745706-61745706
AGintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     2-1627-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
PTPRG     AU2410302chr3:
62033354-62033354
GCintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     1-0863-003chr3:
61838448-61838448
CAintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     2-1188-003chr3:
61902054-61902054
AGintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     1-0052-004chr3:
62106125-62106125
TTTAAAATAAAAGATTGTATAAAAAAAAAGATTGAAintronicDe novo--Yuen2017 G
PTPRG     AU3839302chr3:
61729377-61729377
AGintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     2-0320-003chr3:
62125654-62125654
CTintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     1-0079-003chr3:
61816769-61816769
CGintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     1-0054-004chr3:
61562601-61562608
TCAGATTAGGAAACCCCintronicDe novo--Trost2022 G
PTPRG     1-1134-003chr3:
61586292-61586292
CTintronicDe novo--Trost2022 G
PTPRG     3-0211-000chr3:
61558632-61558632
CTintronicDe novo--Trost2022 G
PTPRG     MSSNG00008-004chr3:
61560104-61560104
GAintronicDe novo--Trost2022 G
PTPRG     14172.p1chr3:
61734741-61734741
TGintronicDe novo8.303-Satterstrom2020 E
PTPRG     10-1019-003chr3:
61551071-61551072
ATAintronicDe novo--Trost2022 G
PTPRG     2-0182-003chr3:
62173847-62173847
AGintronicDe novo--Yuen2017 G
PTPRG     P6Q4Z_01chr3:
61703908-61703908
GAintronicDe novo--Trost2022 G
PTPRG     1-1100-003chr3:
61704745-61704745
GTintronicDe novo--Trost2022 G
PTPRG     1-0282-003chr3:
61692350-61692350
GAintronicDe novo--Trost2022 G
PTPRG     5-0077-003chr3:
61696610-61696612
GAGCAAintronicDe novo--Trost2022 G
PTPRG     MSSNG00439-004chr3:
61630233-61630233
CTintronicDe novo--Trost2022 G
PTPRG     MT_160.4chr3:
61677188-61677188
CTintronicDe novo--Trost2022 G
PTPRG     7-0230-003chr3:
61593648-61593648
GTintronicDe novo--Trost2022 G
PTPRG     1-0182-003chr3:
61618015-61618015
CCTAintronicDe novo--Trost2022 G
PTPRG     AU2320301chr3:
61808407-61808407
TAintronicDe novo--Trost2022 G
PTPRG     2-1402-003chr3:
61967396-61967396
GAintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     3-0116-001chr3:
61810589-61810589
AGintronicDe novo--Trost2022 G
PTPRG     3-0707-000chr3:
61803334-61803334
CGintronicDe novo--Trost2022 G
PTPRG     AU1308303chr3:
61830829-61830830
CACintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     3-0526-000chr3:
61804815-61804815
GAintronicDe novo--Trost2022 G
PTPRG     1028chr3:
61740494-61740494
CTintronicDe novo--Trost2022 G
PTPRG     2-1440-003chr3:
62023113-62023113
AGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PTPRG     AU2320301chr3:
61773055-61773055
GTintronicDe novo--Trost2022 G
PTPRG     4-0082-003chr3:
61712847-61712847
GCintronicDe novo--Trost2022 G
PTPRG     SSC11068chr3:
61734741-61734741
TGintronicDe novo8.303-Trost2022 G
PTPRG     3-0878-000chr3:
61874046-61874046
CTintronicDe novo--Trost2022 G
PTPRG     7-0059-003chr3:
61876775-61876775
CCCTintronicDe novo--Trost2022 G
PTPRG     1-0518-003chr3:
61797711-61797711
AGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PTPRG     7-0048-003chr3:
61852114-61852114
GCintronicDe novo--Trost2022 G
PTPRG     MSSNG00435-003chr3:
61860197-61860197
TTCintronicDe novo--Trost2022 G
PTPRG     AU3730301chr3:
61844744-61844744
AATintronicDe novo--Trost2022 G
PTPRG     7-0048-003chr3:
61849858-61849858
TCintronicDe novo--Trost2022 G
PTPRG     4-0102-003chr3:
61827850-61827850
ACintronicDe novo--Trost2022 G
PTPRG     AU2828301chr3:
61833924-61833924
GAintronicDe novo--Trost2022 G
PTPRG     1-0618-003chr3:
61921841-61921841
CTintronicDe novo--Trost2022 G
PTPRG     AU2323301chr3:
61929781-61929784
TTTGTintronicDe novo--Trost2022 G
PTPRG     1-0555-003chr3:
62230202-62230202
CTintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     SJD_22.3 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
PTPRG     REACH000504chr3:
61895632-61895632
CGintronicDe novo--Trost2022 G
PTPRG     7-0059-003chr3:
61876821-61876821
ATintronicDe novo--Trost2022 G
PTPRG     7-0059-003chr3:
61876825-61876825
CTintronicDe novo--Trost2022 G
PTPRG     2-1283-004chr3:
62193550-62193550
ATintronicDe novo--Yuen2017 G
PTPRG     7-0059-003chr3:
61876783-61876783
AGintronicDe novo--Trost2022 G
PTPRG     7-0059-003chr3:
61876810-61876813
AGCAGGAGintronicDe novo--Trost2022 G
PTPRG     2-1724-003chr3:
62028774-62028774
AGintronicDe novo--Trost2022 G
PTPRG     2-1744-003chr3:
62030049-62030049
CTintronicDe novo--Trost2022 G
PTPRG     1-0262-004Achr3:
62015944-62015945
CTCintronicDe novo--Trost2022 G
PTPRG     MSSNG00013-003chr3:
62022607-62022607
TGintronicDe novo--Trost2022 G
PTPRG     MSSNG00033-004chr3:
61984319-61984320
ACAintronicDe novo--Trost2022 G
PTPRG     MT_89.3chr3:
62004214-62004219
AGTCTCAintronicDe novo--Trost2022 G
PTPRG     MSSNG00421-005chr3:
61949670-61949670
GCintronicDe novo--Trost2022 G
PTPRG     5-5040-003chr3:
61962088-61962088
AGintronicDe novo--Trost2022 G
PTPRG     REACH000525chr3:
62148482-62148482
TCintronicDe novo--Trost2022 G
PTPRG     5-5046-006chr3:
62152241-62152241
CTintronicDe novo--Trost2022 G
PTPRG     AU4479301chr3:
62021021-62021021
CGintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     REACH000738chr3:
62125677-62125677
AGintronicDe novo--Trost2022 G
PTPRG     H3E8D_01chr3:
62146374-62146374
CTintronicDe novo--Trost2022 G
PTPRG     1-0261-004chr3:
62088961-62088964
AAGGCATTGTintronicDe novo--Trost2022 G
PTPRG     MSSNG00466-003chr3:
62110942-62110942
GAintronicDe novo--Trost2022 G
PTPRG     7-0252-003chr3:
62042141-62042141
CTintronicDe novo--Trost2022 G
PTPRG     MSSNG00062-003chr3:
62085620-62085620
GAintronicDe novo--Trost2022 G
PTPRG     AU3861301chr3:
61971830-61971830
GCintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     AU2688301chr3:
62233621-62233621
TAintronicDe novo--Trost2022 G
PTPRG     1-0568-003chr3:
61683656-61683656
AGintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     MT_178.3chr3:
62170400-62170400
TCintronicDe novo--Trost2022 G
PTPRG     1-0568-003chr3:
61682366-61682366
CGintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     4-0034-003chr3:
62171884-62171884
CGintronicDe novo--Trost2022 G
PTPRG     1-0568-003chr3:
61680927-61680927
CTintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     MSSNG00220-003chr3:
62153213-62153213
TGintronicDe novo--Trost2022 G
PTPRG     3-0490-000chr3:
62158235-62158235
GCintronicDe novo--Trost2022 G
PTPRG     1-0568-003chr3:
61686999-61686999
AGintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     142090chr3:
62189088-62189088
CTexonicDe novononsynonymous SNVNM_002841c.C1619Tp.T540M12.156.354E-5Fu2022 E
PTPRG     12738.p1chr3:
61747795-61747795
TCintronicDe novo--Werling2018 G
PTPRG     AU2592303chr3:
62267354-62267354
CTexonicDe novosynonymous SNVNM_002841c.C3882Tp.I1294I--Fu2022 E
PTPRG     AU2756306chr3:
61655423-61655423
TGintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     DEASD_0059_001chr3:
62258653-62258653
TCexonicDe novononsynonymous SNVNM_002841c.T3215Cp.V1072A28.8-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
PTPRG     1-0998-003chr3:
61989047-61989047
AGexonicDe novononsynonymous SNVNM_002841c.A395Gp.Y132C24.22.476E-5Trost2022 G
Yuen2017 G
Zhou2022 GE
PTPRG     2-1511-003chr3:
62000533-62000533
TCintronicDe novo--Yuen2017 G
PTPRG     1-0272-003chr3:
61983075-61983075
GAintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     2-1194-003chr3:
61906554-61906554
CTintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     AU4347301chr3:
61844950-61844950
AGintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     1-0049-004chr3:
62073921-62073921
CTintronicDe novo--Trost2022 G
Yuen2017 G
PTPRG     5-0055-003chr3:
61810280-61810280
GAintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More