or
or
Exact

Results for "DPP10"

Variant Events: 257

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DPP10     2-1296-003chr2:
118148525-118148525
GCintergenicDe novo--Yuen2017 G
DPP10     3-0018-000chr2:
115892944-115892944
GCintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     11089.p1chr2:
115531484-115531484
TAintronicDe novo--Turner2016 G
DPP10     11252.p1chr2:
115718665-115718665
GTintronicDe novo--Turner2016 G
DPP10     12568.p1chr2:
115235072-115235072
GAintronicDe novo--Turner2016 G
DPP10     14370.p1chr2:
115401515-115401515
TAintronicDe novo--Turner2016 G
DPP10     13023.p1chr2:
116827365-116827365
GAintergenicDe novo--Turner2016 G
DPP10     12175.p1chr2:
116868622-116868622
AGintergenicDe novo--Turner2016 G
DPP10     11252.p1chr2:
116695704-116695704
TTAAintergenicDe novo--Turner2016 G
DPP10     AU3636301chr2:
116191596-116191596
GAintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     13023.p1chr2:
116827314-116827314
CGintergenicDe novo--Turner2016 G
DPP10     AU4452302chr2:
116384935-116384935
GCintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     AU3912301chr2:
117741712-117741712
GTintergenicDe novo--Yuen2017 G
DPP10     1-0862-003chr2:
117477119-117477119
GGGTGAintergenicDe novo--Yuen2017 G
DPP10     2-1288-003chr2:
116314601-116314601
GAintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     1-0571-003chr2:
115378449-115378449
CAintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     1-0455-004chr2:
117323987-117323987
TTAGTTATATTTAAGTTATATATTAintergenicDe novo--Yuen2017 G
DPP10     1-0896-003chr2:
115812172-115812172
TCintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     AU3727303chr2:
116089484-116089484
GCintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     2-0713-003chr2:
118167743-118167743
CAintergenicDe novo--Yuen2017 G
DPP10     AU3874303chr2:
116009850-116009850
AGintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     1-0859-003chr2:
116101426-116101426
CTexonicDe novononsynonymous SNVNM_001004360
NM_001178034
NM_001178037
NM_020868
NM_001178036
c.C188T
c.C221T
c.C197T
c.C209T
c.C59T
p.S63F
p.S74F
p.S66F
p.S70F
p.S20F
16.72-Trost2022 G
Zhou2022 GE
DPP10     5-0041-003chr2:
118283314-118283314
GAintergenicDe novo--Yuen2017 G
DPP10     AU4356302chr2:
117017762-117017786
AAAAAAAAAAAAAAAAAAAAAAAACAintergenicDe novo--Yuen2017 G
DPP10     2-1702-004chr2:
117569452-117569452
TCintergenicDe novo--Yuen2017 G
DPP10     AU3874303chr2:
116403074-116403074
CAintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     1-0554-003chr2:
117561132-117561132
CTintergenicDe novo--Yuen2017 G
DPP10     1-0652-004chr2:
116099401-116099405
CTATTCintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     5-0015-004chr2:
117168906-117168906
TCintergenicDe novo--Yuen2017 G
DPP10     5-0015-004chr2:
117537545-117537545
TCintergenicDe novo--Yuen2017 G
DPP10     2-1278-003chr2:
118322925-118322925
TCintergenicDe novo--Yuen2016 G
DPP10     AU1987301chr2:
118329571-118329571
ATintergenicDe novo--Yuen2017 G
DPP10     2-1522-003chr2:
118568641-118568641
TAintergenicDe novo--Yuen2017 G
DPP10     AU012803chr2:
116136175-116136175
ATintronicDe novo--Yuen2017 G
DPP10     AU3955303chr2:
117308020-117308020
TCintergenicDe novo--Yuen2017 G
DPP10     2-1408-003chr2:
117224570-117224570
AAGintergenicDe novo--Yuen2017 G
DPP10     7-0127-003chr2:
118328004-118328004
AGintergenicDe novo--Yuen2017 G
DPP10     5-0025-004chr2:
116997324-116997324
GAintergenicDe novo--Yuen2017 G
DPP10     AU3782303chr2:
115871766-115871766
TCintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     AU055004chr2:
117273859-117273859
AGintergenicDe novo--Yuen2017 G
DPP10     AU051504chr2:
116931490-116931490
GTintergenicDe novo--Yuen2017 G
DPP10     AU2075302chr2:
118064202-118064202
TCintergenicDe novo--Yuen2017 G
DPP10     AU4476302chr2:
116370393-116370393
TCintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     1-0559-004chr2:
116940510-116940510
GAintergenicDe novo--Yuen2017 G
DPP10     5-0099-003chr2:
117568419-117568419
CAintergenicDe novo--Yuen2017 G
DPP10     1-0978-003chr2:
116671694-116671694
GAintergenicDe novo--Yuen2017 G
DPP10     5-0054-003chr2:
116175177-116175177
ATintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     1-0898-003chr2:
116355226-116355226
AGintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     2-1213-003chr2:
116136229-116136229
AGintronicDe novo--Yuen2017 G
DPP10     1-0289-004chr2:
117416132-117416132
AGintergenicDe novo--Yuen2017 G
DPP10     2-1434-003chr2:
117332946-117332946
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
DPP10     1-0215-006chr2:
116562221-116562221
TCintronicDe novo--Yuen2017 G
DPP10     AU1987302chr2:
115565102-115565102
GAintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     5-0111-003chr2:
117772121-117772121
CTintergenicDe novo--Yuen2017 G
DPP10     2-1709-003chr2:
117702276-117702276
TAintergenicDe novo--Yuen2017 G
DPP10     2-1633-003chr2:
118535656-118535656
TCintergenicDe novo--Yuen2017 G
DPP10     AU4235301chr2:
117149796-117149796
AGintergenicDe novo--Yuen2017 G
DPP10     AU002405chr2:
117634809-117634809
CTintergenicDe novo--Yuen2017 G
DPP10     1-0720-003chr2:
118363568-118363568
TCintergenicDe novo--Yuen2017 G
DPP10     2-1398-003chr2:
116769161-116769161
AGintergenicDe novo--Yuen2017 G
DPP10     1-0332-003chr2:
117390653-117390653
CAintergenicDe novo--Yuen2017 G
DPP10     2-0198-004chr2:
117518143-117518143
GAintergenicDe novo--Yuen2017 G
DPP10     AU3801301chr2:
115312300-115312301
GCGintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     AU3761302chr2:
116805299-116805299
TCintergenicDe novo--Yuen2017 G
DPP10     2-1689-003chr2:
115339718-115339718
CTintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     5-0004-003chr2:
117888996-117888996
TTTCACCAAGAGAAGintergenicDe novo--Yuen2017 G
DPP10     1-0606-003chr2:
118174104-118174104
CAintergenicDe novo--Yuen2017 G
DPP10     1-0225-003chr2:
117931247-117931247
GAintergenicDe novo--Yuen2017 G
DPP10     AU079605chr2:
118525858-118525858
TGintergenicDe novo--Yuen2017 G
DPP10     2-0305-004chr2:
117887721-117887721
TCintergenicDe novo--Yuen2017 G
DPP10     1-0985-003chr2:
116093823-116093823
CTintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     AU0638302chr2:
118188276-118188281
AACTATAintergenicDe novo--Yuen2017 G
DPP10     2-1215-003chr2:
116132506-116132506
GAintronicDe novo--Yuen2017 G
DPP10     SP0088041chr2:
116538517-116538517
TCexonicDe novononsynonymous SNVNM_001004360
NM_001178034
NM_001178037
NM_020868
NM_001178036
c.T1408C
c.T1441C
c.T1417C
c.T1429C
c.T1279C
p.Y470H
p.Y481H
p.Y473H
p.Y477H
p.Y427H
21.25.792E-5Fu2022 E
Zhou2022 GE
DPP10     2-1562-003chr2:
115500156-115500156
GAintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     2-1422-003chr2:
115968134-115968134
GCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
DPP10     AU031004chr2:
118554485-118554485
GAintergenicDe novo--Yuen2017 G
DPP10     1-0196-005chr2:
117025406-117025406
GAintergenicDe novo--Yuen2017 G
DPP10     1-0041-003chr2:
118329377-118329377
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
DPP10     2-1635-004chr2:
117475200-117475200
TCintergenicDe novo--Yuen2017 G
DPP10     1-0925-003chr2:
118217282-118217282
ATintergenicDe novo--Yuen2017 G
DPP10     7-0143-003chr2:
115752096-115752096
CTintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     2-1364-003chr2:
117779681-117779681
CAintergenicDe novo--Yuen2017 G
DPP10     AU057405chr2:
118067293-118067293
CTintergenicDe novo--Yuen2017 G
DPP10     2-1690-003chr2:
115384236-115384236
AGintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     AU3343301chr2:
116359876-116359876
CTintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     AU1521301chr2:
116136602-116136602
TGintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     A18chr2:
117812717-117812717
GAintergenicDe novo--Wu2018 G
DPP10     2-1729-003chr2:
117390677-117390677
GCintergenicDe novo--Yuen2017 G
DPP10     AU047704chr2:
117191703-117191703
CTintergenicDe novo--Yuen2017 G
DPP10     13542.p1chr2:
118250328-118250328
AGintergenicDe novo--Werling2018 G
DPP10     2-1339-003chr2:
117376071-117376076
ATAAACAintergenicDe novo--Yuen2017 G
DPP10     2-1507-003chr2:
116418950-116418950
CTintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     2-0198-005chr2:
117518143-117518143
GAintergenicDe novo--Yuen2017 G
DPP10     AU3913301chr2:
115784055-115784055
GTintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     AU3913301chr2:
118065031-118065031
TCintergenicDe novo--Yuen2017 G
DPP10     2-0296-003chr2:
117997199-117997203
GAACAGintergenicDe novo--Yuen2017 G
DPP10     2-1066-004chr2:
115311926-115311926
TAintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     1-0255-003chr2:
115452217-115452217
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
DPP10     1-0458-004chr2:
116018783-116018783
GAintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     2-1715-004chr2:
115251509-115251509
GCintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     2-1581-003chr2:
115291302-115291302
GAintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     AU3891302chr2:
115408740-115408740
ATintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     AU065304chr2:
117833412-117833412
GAintergenicDe novo--Yuen2017 G
DPP10     2-1184-003chr2:
116713000-116713000
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
DPP10     2-1501-003chr2:
115376958-115376958
AGintronicDe novo--Yuen2017 G
DPP10     AU2975301chr2:
116052263-116052263
TCintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     AU4243302chr2:
116648408-116648408
AGintergenicDe novo--Yuen2017 G
DPP10     AU062204chr2:
115551414-115551414
ATintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     1-0777-003chr2:
118537576-118537576
ACintergenicDe novo--Yuen2017 G
DPP10     AU3716302chr2:
117000187-117000187
CTintergenicDe novo--Yuen2017 G
DPP10     14009.p1chr2:
118455408-118455408
TCintergenicDe novo--Wilfert2021 G
DPP10     1-0541-004chr2:
118088187-118088187
GAintergenicDe novo--Yuen2017 G
DPP10     1-0148-005chr2:
117240031-117240043
TATTAATTAATTATATTAATTAintergenicDe novo--Yuen2017 G
DPP10     2-1718-003chr2:
116303569-116303569
CTintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     1-0489-003chr2:
118240661-118240661
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
DPP10     2-0126-004chr2:
115254110-115254110
GTintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     2-1409-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
DPP10     1-0197-003chr2:
118251287-118251287
CAintergenicDe novo--Yuen2017 G
DPP10     AU2485305chr2:
115373219-115373219
AGintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     2-0126-004chr2:
116461004-116461004
CTintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     AU3398301chr2:
116425135-116425135
TCintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     2-1461-003chr2:
118403129-118403129
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
DPP10     2-0202-003chr2:
118159618-118159618
TCintergenicDe novo--Yuen2017 G
DPP10     2-1283-003chr2:
116897285-116897285
CTintergenicDe novo--Yuen2017 G
DPP10     PN400312chr2:
116598397-116598397
CAexonicUnknownnonsynonymous SNVNM_001004360
NM_001178034
NM_001178037
NM_020868
NM_001178036
c.C2233A
c.C2266A
c.C2242A
c.C2254A
c.C2104A
p.Q745K
p.Q756K
p.Q748K
p.Q752K
p.Q702K
29.30.0031Leblond2019 E
DPP10     PN400149chr2:
116598397-116598397
CAexonicUnknownnonsynonymous SNVNM_001004360
NM_001178034
NM_001178037
NM_020868
NM_001178036
c.C2233A
c.C2266A
c.C2242A
c.C2254A
c.C2104A
p.Q745K
p.Q756K
p.Q748K
p.Q752K
p.Q702K
29.30.0031Leblond2019 E
DPP10     AU076509chr2:
117875278-117875278
TCintergenicDe novo--Yuen2017 G
DPP10     AU3885304chr2:
117316071-117316071
CTintergenicDe novo--Yuen2017 G
DPP10     AU4015302chr2:
115738889-115738889
ACintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     AU3997301chr2:
117185290-117185292
TCCTCintergenicDe novo--Yuen2017 G
DPP10     MSSNG00091-003chr2:
115201000-115201000
GTintronicDe novo--Trost2022 G
DPP10     SJD_44.3chr2:
115207442-115207442
TCintronicDe novo--Trost2022 G
DPP10     MSSNG00016-003chr2:
115341565-115341565
TCintronicDe novo--Trost2022 G
DPP10     1-0655-003chr2:
115355587-115355587
GTintronicDe novo--Trost2022 G
DPP10     2-1232-003chr2:
115270267-115270267
GAintronicDe novo--Trost2022 G
DPP10     MSSNG00054-005chr2:
115293802-115293802
CTintronicDe novo--Trost2022 G
DPP10     5-5098-003chr2:
115254935-115254935
TCintronicDe novo--Trost2022 G
DPP10     7-0094-004chr2:
115257694-115257694
AGintronicDe novo--Trost2022 G
DPP10     MSSNG00241-003chr2:
115242309-115242309
TCintronicDe novo--Trost2022 G
DPP10     2-1277-003chr2:
115251001-115251001
GAintronicDe novo--Trost2022 G
DPP10     PN400150chr2:
116598397-116598397
CAexonicUnknownnonsynonymous SNVNM_001004360
NM_001178034
NM_001178037
NM_020868
NM_001178036
c.C2233A
c.C2266A
c.C2242A
c.C2254A
c.C2104A
p.Q745K
p.Q756K
p.Q748K
p.Q752K
p.Q702K
29.30.0031Leblond2019 E
DPP10     5-5001-003chr2:
115488495-115488495
TAintronicDe novo--Trost2022 G
DPP10     7-0198-003chr2:
115533642-115533642
AGintronicDe novo--Trost2022 G
DPP10     1-1184-003chr2:
115472010-115472010
GAintronicDe novo--Trost2022 G
DPP10     MSSNG00067-003chr2:
115475738-115475738
ACintronicDe novo--Trost2022 G
DPP10     3-0719-001chr2:
115395454-115395454
GAintronicDe novo--Trost2022 G
DPP10     1-0509-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2016 G
Yuen2016 G
Yuen2017 G
DPP10     MT_172.3chr2:
115398994-115398994
GAintronicDe novo--Trost2022 G
DPP10     4-0004-003chr2:
115367086-115367086
AGintronicDe novo--Trost2022 G
DPP10     AU1952305chr2:
118281980-118281980
GAintergenicDe novo--Yuen2017 G
DPP10     MSSNG00414-003chr2:
115373245-115373245
GAintronicDe novo--Trost2022 G
DPP10     AU2828301chr2:
115629472-115629472
AGintronicDe novo--Trost2022 G
DPP10     2-0286-004chr2:
116208593-116208593
AGintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     5-0005-003chr2:
115642653-115642653
CGintronicDe novo--Trost2022 G
DPP10     1-0936-003chr2:
118026235-118026235
GAintergenicDe novo--Yuen2017 G
DPP10     2-0162-003chr2:
115598355-115598355
GAintronicDe novo--Trost2022 G
DPP10     1004chr2:
115617628-115617628
CGintronicDe novo--Trost2022 G
DPP10     MSSNG00019-003Achr2:
115585354-115585354
GTintronicDe novo--Trost2022 G
DPP10     2-1137-003chr2:
117173509-117173509
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
DPP10     7-0128-003chr2:
115592447-115592447
ACintronicDe novo--Trost2022 G
DPP10     7-0387-003chr2:
115542514-115542514
GAintronicDe novo--Trost2022 G
DPP10     MSSNG00043-003chr2:
115551272-115551272
GAintronicDe novo--Trost2022 G
DPP10     1-0367-003chr2:
116396552-116396553
TATAAintronicDe novo--Yuen2017 G
DPP10     AU055603chr2:
115821473-115821473
AGintronicDe novo--Trost2022 G
DPP10     MSSNG00452-003chr2:
115824817-115824817
TAintronicDe novo--Trost2022 G
DPP10     14-613chr2:
115767717-115767717
GTintronicDe novo--Trost2022 G
DPP10     7-0149-003chr2:
118109851-118109854
CTGTCTintergenicDe novo--Yuen2017 G
DPP10     MT_81.3chr2:
115781193-115781193
CGintronicDe novo--Trost2022 G
DPP10     AU4168306chr2:
117499465-117499465
TGintergenicDe novo--Yuen2017 G
DPP10     MSSNG00349-004chr2:
115662863-115662863
TCintronicDe novo--Trost2022 G
DPP10     1-0562-003chr2:
115767636-115767636
GAintronicDe novo--Trost2022 G
DPP10     MT_172.3chr2:
115643231-115643231
GAintronicDe novo--Trost2022 G
DPP10     AU2458302chr2:
115660050-115660050
TGintronicDe novo--Trost2022 G
DPP10     2-1335-004chr2:
116445225-116445225
AAGTintronicDe novo--Yuen2017 G
DPP10     2-1491-003chr2:
115876782-115876782
AGintronicDe novo--Trost2022 G
DPP10     AUTPGX_1015chr2:
115885154-115885154
TCintronicDe novo--Trost2022 G
DPP10     2-1486-003chr2:
116114951-116114951
CTintronicDe novo--Yuen2016 G
Yuen2017 G
DPP10     7-0387-003chr2:
115856034-115856048
ACACACCTAGGGTATAintronicDe novo--Trost2022 G
DPP10     MSSNG00368-004chr2:
115857469-115857469
CTintronicDe novo--Trost2022 G
DPP10     1033chr2:
115833092-115833092
TCintronicDe novo--Trost2022 G
DPP10     7-0171-003chr2:
118039312-118039312
GAintergenicDe novo--Yuen2017 G
DPP10     1-0601-003chr2:
115847629-115847629
CTintronicDe novo--Trost2022 G
DPP10     3-0466-000Achr2:
115825364-115825364
GAintronicDe novo--Trost2022 G
DPP10     MSSNG00021-004chr2:
115826495-115826496
CTCintronicDe novo--Trost2022 G
DPP10     1-1063-003chr2:
116009036-116009039
CTTACintronicDe novo--Trost2022 G
DPP10     MSSNG00123-003chr2:
116015486-116015486
GGTintronicDe novo--Trost2022 G
DPP10     2-1183-003chr2:
116134396-116134396
CTintronicDe novo--Yuen2017 G
DPP10     MSSNG00364-004chr2:
116001697-116001697
AGintronicDe novo--Trost2022 G
DPP10     MSSNG00128-003chr2:
116002976-116002976
AGintronicDe novo--Trost2022 G
DPP10     4-0062-003chr2:
115955076-115955077
TCAGintronicDe novo--Trost2022 G
DPP10     5-5217-003chr2:
115969052-115969052
CTintronicDe novo--Trost2022 G
DPP10     REACH000368chr2:
115939442-115939442
GAintronicDe novo--Trost2022 G
DPP10     1-0088-003chr2:
116150248-116150248
CTintronicDe novo--Trost2022 G
DPP10     1-1006-003Achr2:
116159955-116159955
AGintronicDe novo--Trost2022 G
DPP10     AU2207301chr2:
116137604-116137604
GTintronicDe novo--Trost2022 G
DPP10     MSSNG00377-003chr2:
116143223-116143223
AGintronicDe novo--Trost2022 G
DPP10     1-0073-003chr2:
117711185-117711185
CTintergenicDe novo--Yuen2017 G
DPP10     1-1155-003chr2:
116089747-116089747
GCintronicDe novo--Trost2022 G
DPP10     1-1134-004chr2:
116120103-116120103
CTintronicDe novo--Trost2022 G
DPP10     2-1140-003chr2:
117348469-117348469
TCintergenicDe novo--Yuen2017 G
DPP10     3-0017-000chr2:
116020919-116020919
TGintronicDe novo--Trost2022 G
DPP10     7-0103-003chr2:
116030613-116030613
GTintronicDe novo--Trost2022 G
DPP10     AU2310301chr2:
116290514-116290514
ATintronicDe novo--Trost2022 G
DPP10     4-0062-003chr2:
116296186-116296187
AATTintronicDe novo--Trost2022 G
DPP10     3-0328-000chr2:
116243191-116243191
AGintronicDe novo--Trost2022 G
DPP10     1-0158-012chr2:
117840741-117840741
GAintergenicDe novo--Yuen2017 G
DPP10     1-0354-003chr2:
117059660-117059661
ATAintergenicDe novo--Yuen2017 G
DPP10     4-0082-003chr2:
116249630-116249630
AGintronicDe novo--Trost2022 G
DPP10     4-0034-003chr2:
116193186-116193186
GTintronicDe novo--Trost2022 G
DPP10     7-0453-003chr2:
116232243-116232243
TGintronicDe novo--Trost2022 G
DPP10     3-0702-000chr2:
116175727-116175727
GAintronicDe novo--Trost2022 G
DPP10     5-5022-003chr2:
116191139-116191139
GAintronicDe novo--Trost2022 G
DPP10     MT_183.4chr2:
116376108-116376108
CTintronicDe novo--Trost2022 G
DPP10     1-0467-005chr2:
116376663-116376667
CATTTAAAGAintronicDe novo--Trost2022 G
DPP10     AU2320301chr2:
116369586-116369586
ACintronicDe novo--Trost2022 G
DPP10     2-0304-004chr2:
116371100-116371101
TATintronicDe novo--Trost2022 G
DPP10     7-0198-003chr2:
116317736-116317737
AAGGintronicDe novo--Trost2022 G
DPP10     SJD_23.3chr2:
116324457-116324457
GAintronicDe novo--Trost2022 G
DPP10     5-5031-004chr2:
116298573-116298573
GCintronicDe novo--Trost2022 G
DPP10     1-0219-003chr2:
116635220-116635220
CGintergenicDe novo--Yuen2017 G
DPP10     1-1124-003chr2:
116302469-116302469
AGintronicDe novo--Trost2022 G
DPP10     5-0021-003chr2:
117899436-117899436
AGintergenicDe novo--Yuen2017 G
DPP10     7-0227-003chr2:
116439090-116439094
GAAATACACAintronicDe novo--Trost2022 G
DPP10     SP0122608chr2:
116447453-116447454
TCTexonicDe novoframeshift deletionNM_001004360
NM_001178034
NM_001178037
NM_020868
NM_001178036
c.512delC
c.545delC
c.521delC
c.533delC
c.383delC
p.S171fs
p.S182fs
p.S174fs
p.S178fs
p.S128fs
--Trost2022 G
DPP10     AU2577301chr2:
116420769-116420769
ATintronicDe novo--Trost2022 G
DPP10     7-0024-005chr2:
115983640-115983640
AGintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     AU2653301chr2:
116425995-116425995
TTGintronicDe novo--Trost2022 G
DPP10     AU023012chr2:
116398898-116398898
CTintronicDe novo--Trost2022 G
DPP10     AU3765302chr2:
115689106-115689106
GAintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     1-0239-003chr2:
116405494-116405494
GAintronicDe novo--Trost2022 G
DPP10     4-0073-003chr2:
116384935-116384935
GTintronicDe novo--Trost2022 G
DPP10     1-0253-004chr2:
116163955-116163955
GAintronicDe novo--Trost2022 G
Yuen2017 G
DPP10     1-1103-003chr2:
116386054-116386054
AGintronicDe novo--Trost2022 G
DPP10     SP0166588chr2:
116534829-116534829
TGexonicDe novononsynonymous SNVNM_001004360
NM_001178034
NM_001178037
NM_020868
NM_001178036
c.T1246G
c.T1279G
c.T1255G
c.T1267G
c.T1117G
p.W416G
p.W427G
p.W419G
p.W423G
p.W373G
21.1-Trost2022 G
DPP10     2-0205-003chr2:
116547893-116547893
GAintronicDe novo--Trost2022 G
DPP10     1-0090-003chr2:
116486362-116486362
ACintronicDe novo--Trost2022 G
DPP10     2-1720-003chr2:
116626921-116626921
ACintergenicDe novo--Yuen2017 G
DPP10     MSSNG00328-003chr2:
116488826-116488826
CTintronic