or
or
Exact

Results for "PDE4D"

Variant Events: 177

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PDE4D     2-1733-003chr5:
58497667-58497667
ACintronicDe novo--Trost2022 G
PDE4D     2-1644-003chr5:
58516614-58516629
TCAGTTGTGAATTTTCGCCACCGCGCCCGGCCGintronicDe novo--Trost2022 G
PDE4D     2-1369-003chr5:
58496006-58496006
TCintronicDe novo--Trost2022 G
PDE4D     AU2129301 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
PDE4D     2-1369-003chr5:
58496014-58496014
TGintronicDe novo--Trost2022 G
PDE4D     3-0221-000chr5:
58470068-58470068
AATintronicDe novo--Trost2022 G
PDE4D     7-0023-003chr5:
58477940-58477940
GGTintronicDe novo--Trost2022 G
PDE4D     1-0677-004Achr5:
58441480-58441480
TCintronicDe novo--Trost2022 G
PDE4D     SJD_68.3chr5:
58441847-58441847
GAintronicDe novo--Trost2022 G
PDE4D     7-0100-004chr5:
59447374-59447374
GTintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     AU1448303chr5:
58711560-58711560
AGintronicDe novo--Trost2022 G
PDE4D     AU059003chr5:
58713780-58713780
TGintronicDe novo--Trost2022 G
PDE4D     2-1430-005Achr5:
58662932-58662932
CGintronicDe novo--Trost2022 G
PDE4D     1-1213-003chr5:
58677950-58677950
CTintronicDe novo--Trost2022 G
PDE4D     5-0017-004chr5:
58752684-58752684
CTintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     4-0009-003chr5:
58597709-58597709
TGintronicDe novo--Trost2022 G
PDE4D     D4S2Z-01chr5:
58610436-58610436
CTintronicDe novo--Trost2022 G
PDE4D     1-0859-003chr5:
58555281-58555281
GTintronicDe novo--Trost2022 G
PDE4D     2-0135-003chr5:
58739954-58739954
TCintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     SP0180267chr5:
58571948-58571948
GAintronicDe novo--Trost2022 G
PDE4D     MSSNG00383-003chr5:
58872828-58872828
AGintronicDe novo--Trost2022 G
PDE4D     1-1003-003Achr5:
58924133-58924133
CTintronicDe novo--Trost2022 G
PDE4D     1-0352-005chr5:
58628180-58628180
ACintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     7-0105-003chr5:
58810178-58810178
GAintronicDe novo--Trost2022 G
PDE4D     1-0279-004chr5:
58816927-58816929
GGAAAGintronicDe novo--Trost2022 G
PDE4D     5-5027-003chr5:
58786600-58786600
CTintronicDe novo--Trost2022 G
PDE4D     3-0422-000chr5:
58795966-58795966
GAintronicDe novo--Trost2022 G
PDE4D     3-0508-000chr5:
58726065-58726065
GAintronicDe novo--Trost2022 G
PDE4D     2-1347-003chr5:
58746678-58746678
CTintronicDe novo--Trost2022 G
PDE4D     REACH000214chr5:
59032398-59032398
GAintronicDe novo--Trost2022 G
PDE4D     7-0452-003chr5:
59100646-59100646
CGintronicDe novo--Trost2022 G
PDE4D     MSSNG00433-003chr5:
59006160-59006160
GAintronicDe novo--Trost2022 G
PDE4D     3-0630-000chr5:
59011189-59011189
GAintronicDe novo--Trost2022 G
PDE4D     REACH000341chr5:
58982458-58982459
TATintronicDe novo--Trost2022 G
PDE4D     2-1740-003chr5:
58984774-58984774
GAintronicDe novo--Trost2022 G
PDE4D     1-0181-004chr5:
59746002-59746009
TCAGATACTCAGATACAGATACintronicDe novo--Yuen2017 G
PDE4D     AU2320301chr5:
58968749-58968749
GAintronicDe novo--Trost2022 G
PDE4D     7-0497-003chr5:
58976507-58976507
TCintronicDe novo--Trost2022 G
PDE4D     AU071204chr5:
59048478-59048478
TGintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     1-0010-003chr5:
59100778-59100778
TCintronicDe novo--Trost2022 G
PDE4D     REACH000359chr5:
59123097-59123097
GAintronicDe novo--Trost2022 G
PDE4D     1-0010-003chr5:
59100772-59100774
CATTACintronicDe novo--Trost2022 G
PDE4D     1-0269-003chr5:
59100778-59100778
TCintronicDe novo--Trost2022 G
PDE4D     1-0269-003chr5:
59100772-59100774
CATTACintronicDe novo--Trost2022 G
PDE4D     10-0007-003chr5:
59100772-59100774
CATTACintronicDe novo--Trost2022 G
PDE4D     2-1231-003chr5:
58615566-58615566
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PDE4D     1-0269-003chr5:
59100765-59100767
ACACCGintronicDe novo--Trost2022 G
PDE4D     2-1509-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
PDE4D     10-0007-003chr5:
59100765-59100767
ACACCGintronicDe novo--Trost2022 G
PDE4D     REACH000767chr5:
59243437-59243437
TAintronicDe novo--Trost2022 G
PDE4D     7-0459-003chr5:
59274136-59274136
TCintronicDe novo--Trost2022 G
PDE4D     5-1012-003chr5:
59213027-59213027
TCintronicDe novo--Trost2022 G
PDE4D     2-1721-003chr5:
59358477-59358477
GCintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     2-1581-003chr5:
59221006-59221006
AAAAAAAAAAAAGintronicDe novo--Trost2022 G
PDE4D     REACH000713chr5:
59162367-59162367
CTintronicDe novo--Trost2022 G
PDE4D     SP0231745chr5:
59189155-59189155
CTexonicDe novononsynonymous SNVNM_001104631c.G295Ap.G99R14.89-Trost2022 G
PDE4D     MSSNG00378-003chr5:
59155926-59155926
GAintronicDe novo--Trost2022 G
PDE4D     1-1162-003chr5:
59159303-59159305
AATAintronicDe novo--Trost2022 G
PDE4D     1-1063-003chr5:
59411503-59411503
CTintronicDe novo--Trost2022 G
PDE4D     1-0571-003chr5:
59696134-59696134
GAintronicDe novo--Yuen2017 G
PDE4D     MSSNG00369-005chr5:
59419002-59419002
GCintronicDe novo--Trost2022 G
PDE4D     3-0175-000chr5:
59387957-59387957
AGintronicDe novo--Trost2022 G
PDE4D     1-0649-003chr5:
59391491-59391491
TCintronicDe novo--Trost2022 G
PDE4D     3-0253-000chr5:
59368239-59368239
TGintronicDe novo--Trost2022 G
PDE4D     1-0054-004chr5:
59513633-59513633
TCintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     REACH000678chr5:
59375936-59375936
TAintronicDe novo--Trost2022 G
PDE4D     X3N7Y_01chr5:
59352134-59352135
GAGintronicDe novo--Trost2022 G
PDE4D     3-0153-000chr5:
59353446-59353446
GAintronicDe novo--Trost2022 G
PDE4D     7-0354-003chr5:
59515325-59515325
CTintronicDe novo--Trost2022 G
PDE4D     5-5237-005chr5:
59515593-59515594
ATAintronicDe novo--Trost2022 G
PDE4D     1-1204-003chr5:
59514597-59514597
TGintronicDe novo--Trost2022 G
PDE4D     MSSNG00081-003chr5:
59514597-59514597
TGintronicDe novo--Trost2022 G
PDE4D     MSSNG00017-004chr5:
59452523-59452523
CTintronicDe novo--Trost2022 G
PDE4D     7-0392-003chr5:
59475485-59475485
TCintronicDe novo--Trost2022 G
PDE4D     5-5020-003chr5:
59430537-59430537
CTintronicDe novo--Trost2022 G
PDE4D     AU2410301chr5:
58364614-58364614
TAintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     REACH000078chr5:
59433067-59433067
GTintronicDe novo--Trost2022 G
PDE4D     1-0092-003chr5:
59623267-59623267
GAintronicDe novo--Trost2022 G
PDE4D     1-0092-003chr5:
59623271-59623272
AAGGintronicDe novo--Trost2022 G
PDE4D     4-0040-003chr5:
59597054-59597054
AGintronicDe novo--Trost2022 G
PDE4D     4-0040-003chr5:
59597061-59597061
CTintronicDe novo--Trost2022 G
PDE4D     7-0412-003chr5:
59590445-59590445
TAintronicDe novo--Trost2022 G
PDE4D     REACH000423chr5:
59591820-59591820
GAintronicDe novo--Trost2022 G
PDE4D     1-0465-003Achr5:
59516118-59516118
GAintronicDe novo--Trost2022 G
PDE4D     7-0059-003chr5:
59568583-59568584
TTACintronicDe novo--Trost2022 G
PDE4D     4-0108-003chr5:
59712604-59712604
GCintronicDe novo--Trost2022 G
PDE4D     2-1336-004chr5:
58600221-58600223
CTTCintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     7-0198-003chr5:
59680616-59680616
CGintronicDe novo--Trost2022 G
PDE4D     AU3861301chr5:
59701856-59701856
CTintronicDe novo--Trost2022 G
PDE4D     7-0322-003chr5:
59675664-59675664
GAintronicDe novo--Trost2022 G
PDE4D     1-0935-003chr5:
59383808-59383819
GAAAGAATACTTGintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     MSSNG00342-003chr5:
59679460-59679460
TCintronicDe novo--Trost2022 G
PDE4D     1-0099-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
PDE4D     3-0787-000chr5:
59623718-59623718
GAintronicDe novo--Trost2022 G
PDE4D     AU2975301chr5:
58483572-58483572
TCintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     7-0462-003chr5:
59644354-59644355
ATAintronicDe novo--Trost2022 G
PDE4D     AU056804chr5:
58299221-58299221
CTintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     1-0489-003chr5:
58721221-58721221
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PDE4D     1-0507-003chr5:
59343372-59343372
CAintronicDe novo--Yuen2017 G
PDE4D     AU3846302chr5:
58617317-58617317
TCintronicDe novo--Yuen2017 G
PDE4D     1-0458-005chr5:
58914276-58914276
CGintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     2-1318-004chr5:
58374847-58374847
CTintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     1-0352-003chr5:
58628180-58628180
ACintronicDe novo--Yuen2016 G
PDE4D     2-1373-003chr5:
59317734-59317734
CTintronicDe novo--Yuen2016 G
Yuen2017 G
PDE4D     5-0087-003chr5:
58422202-58422202
TCintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     AU2485305chr5:
59475269-59475269
TGintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     AU2022302chr5:
59243126-59243126
GAintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     2-1379-003chr5:
58334397-58334397
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PDE4D     AU3782303chr5:
59057146-59057146
TCintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     AU4467302chr5:
59461967-59461967
GCintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     2-1291-003chr5:
58303287-58303287
CAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PDE4D     AU1988302chr5:
58463257-58463257
TCintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     1-0512-003chr5:
58893353-58893370
AAGAGAGAGAGAGAGAGAAAGAGAGAGAGAGAGAintronicDe novo--Yuen2017 G
PDE4D     2-1222-003chr5:
59509341-59509341
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PDE4D     AU3859301chr5:
58490800-58490800
TGintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     AU076509chr5:
58816817-58816817
GAintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     AU3859301chr5:
59618650-59618650
CTintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     ASC_2J789-9A138chr5:
59064075-59064075
TCexonicDe novosynonymous SNVNM_001197218c.A261Gp.T87T--Fu2022 E
PDE4D     1-0373-003chr5:
58275511-58275511
TGintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     3-0482-000chr5:
58735799-58735799
AGintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     AU3713302chr5:
58522735-58522735
GAintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     1-0572-003chr5:
59382812-59382812
GAintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     1-0382-004chr5:
58374093-58374093
ACintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     AU3875301chr5:
58350963-58350963
GCintronicDe novo--Yuen2017 G
PDE4D     11724.p1chr5:
58285584-58285584
CAexonicMosaicstopgainNM_001197222
NM_001197223
NM_001197221
NM_001104631
NM_001197218
NM_001197219
NM_001197220
NM_006203
NM_001165899
c.G778T
c.G577T
c.G544T
c.G1450T
c.G1258T
c.G1084T
c.G1060T
c.G1042T
c.G1267T
p.E260X
p.E193X
p.E182X
p.E484X
p.E420X
p.E362X
p.E354X
p.E348X
p.E423X
38.0-Dou2017 E
PDE4D     2-0144-003chr5:
59277195-59277195
GTintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     AU4392302chr5:
58284262-58284262
TCintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     AU3862305chr5:
58993904-58993905
ATAintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     AU4199303chr5:
58308965-58308965
AGintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     1-0638-003chr5:
58967815-58967815
CAintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     1-0173-004chr5:
59185598-59185600
AGTAintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     1-0465-003chr5:
59516118-59516118
GAintronicDe novo--Yuen2017 G
PDE4D     AU4228301chr5:
58509568-58509568
TCintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     AU3646301chr5:
59403270-59403270
CGintronicDe novo--Yuen2017 G
PDE4D     1-0206-005chr5:
58957520-58957520
GAintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     SP0025964chr5:
58334589-58334589
CGintronicDe novo--Fu2022 E
PDE4D     AU3903301chr5:
58929206-58929206
AGintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     SP0006743chr5:
58271499-58271499
GAexonicDe novosynonymous SNVNM_001197222
NM_001197223
NM_001197221
NM_001104631
NM_001197218
NM_001197219
NM_001197220
NM_006203
NM_001165899
c.C1326T
c.C1125T
c.C1092T
c.C1998T
c.C1806T
c.C1632T
c.C1608T
c.C1590T
c.C1815T
p.S442S
p.S375S
p.S364S
p.S666S
p.S602S
p.S544S
p.S536S
p.S530S
p.S605S
-1.74E-5Fu2022 E
Trost2022 G
Zhou2022 GE
PDE4D     1-0973-003chr5:
59238055-59238055
GAintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     3-0080-000chr5:
58522577-58522577
TAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PDE4D     AU072904chr5:
59691521-59691521
CGintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     1-0514-003chr5:
59572182-59572182
CGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PDE4D     AU2293301chr5:
59243088-59243088
GAintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     11341.p1chr5:
58297024-58297024
AGintronicDe novo--Turner2016 G
PDE4D     SP0094143chr5:
58571353-58571353
AGUTR5De novo--Fu2022 E
Trost2022 G
PDE4D     2-0012-003chr5:
58796981-58796983
TCATintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     SP0094529chr5:
58571241-58571241
TAUTR5De novo-5.44E-5Fu2022 E
PDE4D     13393.p1chr5:
58739572-58739572
CTintronicDe novo--Turner2016 G
PDE4D     SP0140973chr5:
58652526-58652526
CTintronicDe novo--Fu2022 E
PDE4D     3-0446-000chr5:
58596228-58596228
CTintronicDe novo--Yuen2016 G
Yuen2017 G
PDE4D     2-0109-003chr5:
59120190-59120190
TTAGCAintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     7-0128-003chr5:
58865291-58865291
CTintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     2-1437-004chr5:
58919470-58919470
AGintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     A20chr5:
59680684-59680684
TCintronicDe novo--Wu2018 G
PDE4D     2-1254-003chr5:
59104395-59104395
TCintronicDe novo--Yuen2016 G
Yuen2017 G
PDE4D     2-1437-004chr5:
59411479-59411479
TCintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     2-1290-004chr5:
59636092-59636092
CTintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     2-1120-003chr5:
59452931-59452931
AGintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     13026.p1chr5:
59736662-59736662
CTintronicDe novo--Werling2018 G
PDE4D     MSSNG00251-003chr5:
58335030-58335031
CGCUTR5De novo--Trost2022 G
PDE4D     AU2442301chr5:
58339266-58339266
CTintronicDe novo--Trost2022 G
PDE4D     2-1174-005Bchr5:
59303877-59303877
CCTATAAGATATAAGATATATAAGATAintronicDe novo--Yuen2017 G
PDE4D     7-0308-003chr5:
58303898-58303898
TAintronicDe novo--Trost2022 G
PDE4D     3-0284-000chr5:
58321779-58321779
TCintronicDe novo--Trost2022 G
PDE4D     1-0928-003chr5:
58275885-58275886
CCTTintronicDe novo--Trost2022 G
PDE4D     MSSNG00153-003chr5:
58279311-58279311
AGintronicDe novo--Trost2022 G
PDE4D     5-0109-003chr5:
59743408-59743408
CTintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     AU1698302chr5:
58683685-58683685
AGintronicDe novo--Trost2022 G
Yuen2017 G
PDE4D     2-0309-005chr5:
58423392-58423392
GCTintronicDe novo--Trost2022 G
PDE4D     5-5153-003chr5:
58428279-58428279
CAintronicDe novo--Trost2022 G
PDE4D     MT_63.3chr5:
58404165-58404165
ACintronicDe novo--Trost2022 G
PDE4D     7-0405-003chr5:
58418977-58418977
TCintronicDe novo--Trost2022 G
PDE4D     REACH000258chr5:
58394245-58394245
CGintronicDe novo--Trost2022 G
PDE4D     1-0487-003chr5:
59282723-59282723
CGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
PDE4D     5-0066-003chr5:
58403016-58403016
GAintronicDe novo--Trost2022 G
PDE4D     AU3874302chr5:
58345678-58345678
CCTintronicDe novo--Trost2022 G
PDE4D     1-0616-003chr5:
58379227-58379227
AATintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More